Question Regarding the Reporting of A Novel 7-Base-Pair Deletion

[Motahareh Jadidi]

Dear HGVS,

I hope this message finds you well. I have two questions about a frameshift deletion I have identified, which has my mind very involved. I'd appreciate it if you could kindly help me with it.

Question 1: I want to know how to report the amino acid change in my case.
Question 2:  I want to know if the variant itself is still considered novel in my case.

My case : There is a 7-base-pair frameshift deletion, which is novel, leading to a change at the amino acid level, which is already reported!!

Context of Question 1:

(The reference used is hg19, NPHP4 NM_015102.5:c.2995_3001delTGTTGTG, NP_055917.1)

- The NPHP4 gene is located on the reverse strand. The wild and mutant types are provided below:

Wild-type : 5' CACAACACACAGCACACGGTGACT 3'

The deletion happens in the first 7-base-pair: CACAACA

The new mutated sequence is: CACAGCACACGGTGACT

- The wild-type protein sequence is:

His-Asn-Thr-Gln-His-Thr-Val-Thr

This is an 8-amino-acid segment, corresponding to the 24 nucleotides in CACAACACACAGCACACGGTGACT

- The mutated protein sequence is:

His-Ser-Thr-Arg-Stop

- The codon changes: 

• Wild-type: His (CAC) → Mutated: His (CAC) (coincidental match) (As you can see, the first His will remain unchanged.)
  

• Wild-type: Asn (AAC) → Mutated: Ser (AGC)
  
• Wild-type: Thr (ACA) → Mutated: Thr (ACA) (coincidental match)
  
• Wild-type: Gln (CAG) → Mutated: Arg (CGG)
  
• Wild-type: His (CAC) → Mutated: Stop (TGA)
  
  

Now that you can see that despite the frameshift, the first amino acid, histidine, remains completely unchanged (even on the codon level). Now I want to know if I should report the amino acid change like this or not:

p. Asn1000Serfs*4

Context of Question 2:

In the paper below, they have reported this variant (which happens 5 nucleotides downstream of mine) and the protein change, which is like mine :

Identification of a Novel Deletion Variant (c.2999_3005delTGTGTGT/p.Asn1000SerfsTer4) in NPHP4 Associated With Nephronophthisis-4 (Ref: https://doi.org/10.1002/jcla.25077)

Now, given the information that my different variant will ultimately lead to a similar amino acid change, I want to know if my variant is still considered novel?

Thank you for your consideration and support. I there are any questions or you need more clarification on the situation, do not hesitate to contact me. Thank you.

Best regards,

Motahareh Jadidi

[Motahareh Jadidi]

[Johan den Dunnen]

Dear Motahareh,

regarding your first question, the correct description of the first variant is NM_015102.5:c.2999_3005del p.(Asn1000SerfsTer4).
NM_015102.5:c.2995_3001delTGTTGTG is not following HGVS nomenclature: the 3'rule is not applied, the deleted sequence should not be listed (and the deleted sequence is not TGTTGTG). Your description of the predicted effect on protein level is correct, except for the missing "()" to indicate it are predicted consequences on the protein level.

Regarding your second question, the variant you detected is the same as that published in the paper you mention. Again, correct is c.2999_3005del not c.2999_3005delTGTGTGT.

Best regards,

Johan den Dunnen
HUGO HGVS Variant Nomenclature Committee (HVNC)

Op maandag 28 april 2025 om 13:20:23 UTC+2 schreef Motahareh Jadidi:

[Motahareh Jadidi]

Dear HGVS, 

hope this message finds you well. I wanted to follow-up on the previous questions I asked you in my last email. I would be deeply grateful if I can have your answer in my questions. 

Thank you so much for your time and consideration.

Warm regards,

Motahahreh Jadidi

[i.f.a.c...@lumc.nl]

Dear Motahahreh,

Your first email had been answered on the Google Group. I see you didn't get a Cc of the reply. In case you missed the reply, see:

https://groups.google.com/g/hgvs-nomenclature/c/s3WjnIu15q4

Best regards,

Ivo Fokkema

HGVS Variant Nomenclature Committee

---

From: 'Motahareh Jadidi' via HGVS Nomenclature <hgvs-nom...@googlegroups.com>
Sent: Tuesday, June 3, 2025 09:45
To: hgvs-nom...@googlegroups.com <hgvs-nom...@googlegroups.com>
Subject: [hgvs-nomenclature] Re: Question Regarding the Reporting of A Novel 7-Base-Pair Deletion

 

--
You received this message because you are subscribed to the Google Groups "HGVS Nomenclature" group.
To unsubscribe from this group and stop receiving emails from it, send an email to hgvs-nomenclat...@googlegroups.com.
To view this discussion visit https://groups.google.com/d/msgid/hgvs-nomenclature/c5009508cee2b0b809eb4518e3291efd3869eb90%40ut.ac.ir.