Genetic Superpowers

[Jason Bobe]

The conversation earlier this week about genetic variants related to the trait of absolute pitch got me wondering whether people on the list have other favorite "superpowers" w/ known genetic variants associated with them.

For example,

1. Norovirus resistance and FUT2 W154X
   
2. Extra strong bones and LRP5
   
3. Lean muscle and MSTN double null (see cases like bodybuilder Flex Wheeler, dogs that look like bodybuilders and others)
   
4. Greatly reduced heart disease and PCSK9
   

Any other favorite superpowers w/ associated genetic variants?

Jason

[Bryan Bishop]

On Fri, Jun 22, 2012 at 9:10 PM, Jason Bobe <jaso...@gmail.com> wrote:

Any other favorite superpowers w/ associated genetic variants?

Candidate genes for sports doping:

http://diyhpl.us/~bryan/papers2/gene_doping_for_sports_enhancement.png

ACE

ACTN3

HIF

myostatin/follistatin

PPAR-delta

VEGF

IGF-1

HGH

also, whatever that celery taste allele was.

- Bryan
http://heybryan.org/
1 512 203 0507

[Dan Wright]

Rs333

is a	snp
is	mentioned by
dbSNP	rs333
PheGenI	rs333
nextbio	rs333
hapmap	rs333
1000 genomes	rs333
hgdp	rs333
ensembl	rs333
gopubmed	rs333
geneview	rs333
scholar	rs333
google	rs333
pharmgkb	rs333
gwascentral	rs333
openSNP	rs333
23andMe	rs333
23andMe all	rs333
SNP Nexus
SNPshot	rs333
SNPdbe	rs333
MSV3d	rs333

Gene

CCR5

Chromosome

3

Orientation

plus

Position

46414947

Reference

GRCh37 37.1/131

Max Magnitude

4

Geno	Mag	Summary
(-;-)	4	very resistant to HIV
(-;GTCAGTATCAATTCTGGAAGAATTTCCAGACA)	2	resistant to HIV
(GTCAGTATCAATTCTGGAAGAATTTCCAGACA;GTCAGTATCAATTCTGGAAGAATTTCCAGACA)	0	common form

The chemokine receptor gene CCR5 plays an important role in many immune-related processes. Delta 32 rs333, designating the CCR5-delta32 deletion of 32 nucleotides from within the gene, is perhaps the most famous allele of CCR5. 23andMe tests for this by the name I3003626.

Individuals carrying one copy of the delta 32 allele are somewhat resistant to infection by HIV, the virus that causes AIDS, and individuals with 2 copies (delta 32 homozygotes, ~1% of Caucasians) are almost completely immune to infection by HIV. [PMID 8898752] The delta 32 allele may have been selected for in European populations because it confers resistance to plague (Black Death) or smallpox. [1]

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.

[ruphos]

agree SO HARD

You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.

--
"And if ye cannot be saints of knowledge, then be at least its warriors."
-- Friedrich Nietzsche

[Lisa Thalheim]

http://news.sciencemag.org/sciencenow/2009/08/13-02.html /
http://www.sciencemag.org/content/325/5942/866.abstract:

"We have identified a mutation in a transcriptional repressor
(hDEC2-P385R) that is associated with a human short sleep phenotype."

> --

> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com.

> To view this discussion on the web visit
> https://groups.google.com/d/msg/diybio/-/_e-9-te5BaAJ.

[Jason Bobe]

On Sat, Jun 23, 2012 at 8:03 AM, Lisa Thalheim <ltha...@googlemail.com> wrote:

http://news.sciencemag.org/sciencenow/2009/08/13-02.html /
http://www.sciencemag.org/content/325/5942/866.abstract:

"We have identified a mutation in a transcriptional repressor
(hDEC2-P385R) that is associated with a human short sleep phenotype."

Hey Lisa, I had't seen this one before.  Cool!

Jason

[Andrew Hessel]

Jason, this is great.  Would you be interested in co-writing a short piece on this?  Almost writes itself, and I think I can get it in wired or Popsci easy.

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.

[Bryan Bishop]

On Sat, Jun 23, 2012 at 9:09 AM, Andrew Hessel <ahe...@gmail.com> wrote:

Jason, this is great.  Would you be interested in co-writing a short piece on this?  Almost writes itself, and I think I can get it in wired or Popsci easy.

I'd be down for that.

Where is that hangover resistance SNP? I used to know it. :-(

[Andrew Hessel]

Now that's a superpower!

Anyone know if short sleep cycles has been correlated yet?  :-)

--

[Mega]

I love high bone mass (HBM) mutations. For normal people very helpful, but especially for astronauts!!

Also cool is HIV resistance (I read that 10% of Europeans have it?!)


Another mutation which would be very very helpful is more myoglobine (or something similar). It happens sometimes that people are in their car and it falls into a lake. Before the car has filled up with water, you cannot open the dors (pressure way to strong) . This takes more than 5 minutes and your brain begins to die after some 3 Minutes. If you had accumulated oxygen like a seal, and could live without breathing for 20 Minutes, you just would not care. Wait 10 Minutes, open the dor and get out of it.
Same matter also when you have an accident and you have to wait for the ambulance to come. The chances of survival would be much better.

(May I add, a second heart would be great. Some animals have up to nine -small- hearts. )



And I still have to add something:
Most higher organisms get scars when you cut off their arms/legs, but salamanders/lizards just grow new arms/legs.
Surely, 30'000 years ago a human didn't have the food (calories) to grow a new one and was more likely to survive with a scar (and still could propagate).
But nowadays, it would be affordable for the human body.

Wisdom teeth -> retarded -> out. Maybe teeth should grow not twice but in periodic intervals.

Ageing, retarded. Get the s*it out of our genes!

[Pieter]

Be careful not to make a foul out of yourself in an article by using false logic too much:

True Statement A: High bone mass is beneficial to austronats

True Statement B: LRP5 mutation causes high bone mass

Possibly False Statement: LRP5 mutation is beneficial to austronats

Remember that DNA only compares to computer programming to a limited extent. In reality cells are operating under constantly changing physical/metabolic/life cycle conditions, and the proteins that genes code for might have dozens of interactions in diverse pathways. The gene expression system itself is also heavily regulated based on feedback too. A gene hardly ever operates like an object in a piece of C# code with a single function.

Also, genotypes that appear to have adverse effects, result in opposite fenotypes all the time. For example:

- BRCA has been linked to high fertility in women

- Cystic Fibrosis increases resistance to cholera

And don't forget our species has also go through a very sophisticated behavioural evolution, causing interesting patterns we study in psychology. Perhaps the fact that one knows to be HIV resistant results in a more risky sexual behaviour? That might cause more harm than the initial risk of becoming HIV positive.

So be sure to mention your oversimplification of functional genomics. Anyone that has done simple genetic engineering knows how hard it is to match the outcome with the models prediction, even in bacteria.

[Thomas Landrain]

I +1 your comments Pieter. An article about alleles associated with phenotypes that are close to what we consider being nature gifts would be awesome! But it would fast become fragile to critics if it doesn't state what's the real genetic complexity behind phenotypes as Pieter presented it here. 

T

--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.

To view this discussion on the web visit https://groups.google.com/d/msg/diybio/-/Wm3UEJkVyWcJ.

[Phil]

On Saturday, 23 June 2012 08:03:14 UTC-4, Lisa Thalheim wrote:

http://news.sciencemag.org/sciencenow/2009/08/13-02.html /
http://www.sciencemag.org/content/325/5942/866.abstract:

"We have identified a mutation in a transcriptional repressor
(hDEC2-P385R) that is associated with a human short sleep phenotype."

I remember reading that article, and that there was no evidence that the 2 subjects (there were only 2 subjects in this study!) were not sleep-deprived.  This mutation may have simply given them a low-grade insomnia.

[Bryan Bishop]

On Fri, Jun 22, 2012 at 9:20 PM, Bryan Bishop <kan...@gmail.com> wrote:

Candidate genes for sports doping:

http://diyhpl.us/~bryan/papers2/gene_doping_for_sports_enhancement.png

On that note.. the anti-doping organizations provide a list of interesting substances:

http://www.wada-ama.org/Documents/World_Anti-Doping_Program/WADP-Prohibited-list/2012/WADA_Prohibited_List_2012_EN.pdf

But they sorta dance around the gene doping issues by banning all of it, rather than outlining useful things.