calling the SNP

237 views
Skip to first unread message

Mackenzie Cowell

unread,
Jun 19, 2012, 6:48:43 PM6/19/12
to diybio
Brian D and I were talking about "SNP calling" with PCR and sequencing.  We lamented the technicalities involved.  So here's a challenge: can anyone "call the SNP" & the phenotype of the following amplicon sequence?  There's a SNP in there somewhere.

GTAAGAAGTGAAGGGGCTGGACCTGTCTGTGAATCAGAATGAGCCCACGTCCTCCAGGAAGGTTTTTTATAGCCTCCTCTCCCAAATGGAAAAGCCAAATCCATCACTGATGCTTCCATCAGAACCTGTAGAGGTACTATCATAACACCTTCCACACAGTTTAGTGCACTTAACCTGGAAACCAGTTACCTCCATTGTGAGCTTTGAGGCCTGGGGCTCTGTTGCTACGCGTTTGTTTCACTAGTGCTAAGAGTGGAATGTAGCAGATGTTCAGCACATGATTGCTGAGTAAAAGCCATCCTTTGTGGC

Cheers
Mac 

--
+1.231.313.9062 / m...@diybio.org / @100ideas

Cory Tobin

unread,
Jun 19, 2012, 7:40:39 PM6/19/12
to diy...@googlegroups.com
rs3057 Associated with perfect pitch.

CATCA (C/T) TGATG

Do I win a prize? :P


-cory




--
Cory Tobin
Graduate Student
Caltech :: Biology
cto...@caltech.edu
805-443-4702
1200 E. California Blvd MC156-29
Pasadena CA, 91125

Bryan Bishop

unread,
Jun 19, 2012, 7:52:11 PM6/19/12
to diy...@googlegroups.com, Bryan Bishop
On Tue, Jun 19, 2012 at 6:40 PM, Cory Tobin <cory....@gmail.com> wrote:
Do I win a prize? :P

You win a new limited edition FBI trading card. Um, let's see... Francisella tularensis?

- Bryan
http://heybryan.org/
1 512 203 0507

Aaron Vollrath

unread,
Jun 19, 2012, 7:57:36 PM6/19/12
to diy...@googlegroups.com
didn't Francisella tularensis retire in the late 60s?  i can't seem to recall what team he played for....


--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.

Jeswin

unread,
Jun 19, 2012, 10:33:49 PM6/19/12
to diy...@googlegroups.com
Can you explain this? Is this a single sequence? How do you find the
SNP and phenotype?

ruphos

unread,
Jun 20, 2012, 12:29:34 AM6/20/12
to diy...@googlegroups.com
BLAST: http://blast.ncbi.nlm.nih.gov/

Top result with highest score and smallest E value:
rs=3057|pos=301|len=601|taxid=9606|mol="genomic"|class=1|alleles="A/G"|build=132


--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.




--
"And if ye cannot be saints of knowledge, then be at least its warriors."
-- Friedrich Nietzsche

ruphos

unread,
Jun 20, 2012, 12:40:43 AM6/20/12
to diy...@googlegroups.com

Top result with highest score and smallest E value:
rs=3057|pos=301|len=601|taxid=9606|mol="genomic"|class=1|alleles="A/G"|build=132

--> left menu -- Phenotype Data


On Tue, Jun 19, 2012 at 7:33 PM, Jeswin <phill...@gmail.com> wrote:
--
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To post to this group, send email to diy...@googlegroups.com.
To unsubscribe from this group, send email to diybio+un...@googlegroups.com.
For more options, visit this group at http://groups.google.com/group/diybio?hl=en.

Brian Degger

unread,
Jun 20, 2012, 6:11:07 AM6/20/12
to diy...@googlegroups.com
Thanks Ruphos,
Very useful to know.

Anyone know which nucleotide is associated with having perfect pitch C or T?
Or are there SNPs where the correlation is with heterozygosity?

Cheers
Brian D.
------------------------------------------
Brian Degger
http://transitlab.org
twitter: @drbrian
locale: Newcastle, UK
------------------------------------------

Lisa Thalheim

unread,
Jun 20, 2012, 9:10:20 AM6/20/12
to diy...@googlegroups.com
The description says C is the reference and T is the alternative, so T
would be associated with perfect pitch:
http://www.ensembl.org/Homo_sapiens/Variation/Phenotype?db=core;r=8:131329337-131330337;v=rs3057;vdb=variation;vf=49281667

Mac Cowell

unread,
Jun 20, 2012, 9:23:03 AM6/20/12
to diy...@googlegroups.com, diy...@googlegroups.com
Way to go DIYBIO & Cory, Ruphos, & Lisa. You all win a free postcard! Just drop me your address: Diybio.org/postcards.

231.313.9062 // @100ideas // sent from my rotary phone

Bastian Greshake

unread,
Jun 20, 2012, 9:31:33 AM6/20/12
to diy...@googlegroups.com
Are you sure about this?

I mean: Yes, C is given as the reference allele, but it is also the minor allele (MAF 0.37) and among the openSNP-users nearly 33 % carry the T/T genotype and only ~10 % carry C/C. Overall the openSNP-numbers more or less fit those of dbSNP if you expect HWE.

Wouldn't one expect the rare genotype to be the one associated with perfect pitch?

Cheers,
Bastian (Rs3057 T/T, quite sure he doesn't have the perfect pitch ;))

Simon Quellen Field

unread,
Jun 20, 2012, 12:23:40 PM6/20/12
to diy...@googlegroups.com
I would be really surprised if a single SNP suddenly made you have perfect pitch
without any training. It could well be that most of us have the capacity, except
for some poor folks who lost the genetic lottery. Not likely, but quite possible.
I'll bet there are people with perfect pitch who have all four/(three) combinations,
and likewise for people without perfect pitch.

-----
Get a free science project every week! "http://scitoys.com/newsletter.html"

Bastian Greshake

unread,
Jun 20, 2012, 1:05:35 PM6/20/12
to diy...@googlegroups.com
Of course, it isn't a binary thing (allele A => Perfect Pitch, allele B => Non-Perfect-Pitch) but if they found significant linkage it should be more likely that you find the association of rare genotype <-> rare trait than the other way round.
// Bastian Greshake
// Zehnthofstraße 36
// 55252 Mainz-Kastel, Germany
// cell: +49 176 213 044 66
// web: www.ruleofthirds.de






Simon Quellen Field

unread,
Jun 20, 2012, 1:20:59 PM6/20/12
to diy...@googlegroups.com
You are assuming perfect pitch is rare.

That is probably true, but if determining it requires training a bunch of people for
a long time, and then testing them to see how well they can name notes, it might
be that more people actually pass the test after training than otherwise. It only
seems rare because few people are that highly trained.

If I set up a test to determine perfect multipliers, and train people to memorize the
multiplication tables, I might find some SNPs that make it difficult for people to do
the task. But the SNP that makes it hard to do multiplication might be rare, even if
perfect multipliers are rare in untrained populations.

-----
Get a free science project every week! "http://scitoys.com/newsletter.html"




Bastian Greshake

unread,
Jun 20, 2012, 3:51:22 PM6/20/12
to diy...@googlegroups.com
The publication which found the link between the SNP and the perfect pitch/absolute pitch (AP) says it's not just training and distinguishable from those who "merely" train themselves to have a similar skill:

«Identification is instantaneous and quite effortless for those who possess AP, much as the assignment of visible light frequencies with color names is for most people. It is distinguishable from relative pitch, a learned ability common in trained musicians, in which the pitch of a tone is inferred by mental comparison to an external reference tone.

AP is a complex trait, and both environmental and genetic factors may play a role in its genesis. Musical training during a critical period of childhood development1–4 probably contributes to the acquisition of AP, but this training alone is insufficient; many people receive early musical training but do not develop AP.» – http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2706961/?tool=pubmed

And from the OMIM-page: «Gregersen et al. (2001) surveyed 1,067 music students enrolled in music theory classes in the United States and found an overall AP rate of 12.2%, with a markedly increased rate of AP in Asian students (47.5%) compared to Caucasian students (9.0%).» - http://www.omim.org/entry/159300

So it seems to be kind of rare, even in those of European descent (the group mainly studied in the GWA) who have a musical background. :-)

Cheers,
Bastian

On Jun 20, 2012, at 19:20 , Simon Quellen Field wrote:

> That is probably true, but if determining it requires training a bunch of people for
> a long time, and then testing them to see how well they can name notes, it might
> be that more people actually pass the test after training than otherwise. It only
> seems rare because few people are that highly trained.

Lisa Thalheim

unread,
Jun 20, 2012, 8:14:12 PM6/20/12
to diy...@googlegroups.com
Hey Bastian,

compelling argument. i tried to look into the studies some more, and
as usually the case with these things, it's less clear to me now than
before. The study by Theusch et al that identified this association
between AP and rs3057 contains a lot of cautionary statements. They
write that "Our LOD scores were modest in comparison to the
theoretical maximum nonparametric multipoint exponential LOD scores
predicted for our samples";

Then, the rs3057 association seems to be valid only for the test
population of European descent: "Notably, there was no
evidence in the E Asian population for linkage in the region of
significant linkage (8q24.21) from the Eu sample set. In fact, the
chromosome 7 region was the only E Asian region with a LOD score over
1.0 that showed overlap with linkage peaks observed in the Eu data set
(Figure 2A).";

The test subjects were only genotyped for a very modest number of 6090
SNPs, not even taking into account a huge number of known SNPs, or
other types of genomic variation, or epigenetic variation (not that
this would necessarily yield a good answer...); and on and on.

And then there's another study referenced in the OMIM entry:
"Reanalyzing data from Gregersen et al. (2001), Henthorn and Deutsch
(2007) stated that having spent early childhood in Asia appeared to be
the significant differentiating factor in prevalence of AP and
suggested that exposure to tonal language in infancy may predispose to
the acquisition of AP. Gregersen et al. (2007) responded that full
analysis of their data reveals that age of music training and exposure
to 'fixed do' training before age 7 are the only factors that strongly
predict the development of AP, in both Asians and Caucasians."

So I still don't really know whether the C or the T allele (or maybe
only a CC genotype? or only a TT genotype?) is associated with AP. My
current best guess, though, is "none of the above". Sigh. It's going
to take a long time until we figure out this whole genotype/phenotype
thing, not to mention the mechanisms by which the two are linked. For
the time being, I feel like reading SNPs is more like reading teacups
and omens than anything else, waving fancy statistical tools rather
than dead roosters...

Cheers,
lisa

Simon Quellen Field

unread,
Jun 20, 2012, 8:27:40 PM6/20/12
to diy...@googlegroups.com
It would be interesting to see what the gene involved actually codes for.
It could be developmental, or it could be behavioral, with one allele fostering
better attention while learning music before age 7. The kids that won't tolerate
being forced to learn scales at an early age might be less inclined to have absolute
pitch.

Of course, genetics working the way it does, perhaps it is the parent who has the
gene that is more likely to force the kid to have early music lessons. Then it may be
not so rare. What would make it appear rare is the low probability of success in
getting the kid to study. The fact that the kid also has the gene is mere coincidence.

If nearly half of all Asians tested had absolute pitch, it does not sound all that rare.
And since the Asians did not have the SNP, obviously it is not required for absolute
pitch. It may simply be the gene that makes parents sing to their kids.

If a SNP makes a gene totally fail, and that gene is necessary for proper function,
then it is generally not hard to say "this SNP causes this trait". But for traits that
are more subtle, and that don't cause harm with or without the SNP, things are usually
much muddier and harder to prove.

-----
Get a free science project every week! "http://scitoys.com/newsletter.html"




Simon Quellen Field

unread,
Jun 20, 2012, 8:29:40 PM6/20/12
to diy...@googlegroups.com
One more thing -- I have a friend who claims his absolute pitch only came to him
after he contracted tinnitus from a car accident injury. The tinnitus pitch is the
standard against which he can compare any other note he hears.

Perhaps the SNP is related to tinnitus?
:-)

-----
Get a free science project every week! "http://scitoys.com/newsletter.html"




Cory Tobin

unread,
Jun 20, 2012, 8:46:39 PM6/20/12
to diy...@googlegroups.com
> It would be interesting to see what the gene involved actually codes for.

The gene is called ASAP1
http://uswest.ensembl.org/Homo_sapiens/Gene/Summary?db=core;g=ENSG00000153317;r=8:131329787-131329887;v=rs3057;vdb=variation;vf=49281667

Codes for a protein called DDEF1
http://en.wikipedia.org/wiki/DDEF1


-cory

Simon Quellen Field

unread,
Jun 20, 2012, 9:06:20 PM6/20/12
to diy...@googlegroups.com
Thanks -- that's a lot more than I knew before.

However, knowing that it produces a protein that interacts with a cancer gene is
information, but that bit of information adds little to our knowledge of how it might
affect absolute pitch.

Was there any hint as to a mechanism given in the paper?

-----
Get a free science project every week! "http://scitoys.com/newsletter.html"




Bastian Greshake

unread,
Jun 21, 2012, 5:18:56 AM6/21/12
to diy...@googlegroups.com
On 21 June 2012 02:14, Lisa Thalheim <ltha...@googlemail.com> wrote:
 
So I still don't really know whether the C or the T allele (or maybe
only a CC genotype? or only a TT genotype?) is associated with AP. My
current best guess, though, is "none of the above". Sigh. It's going
to take a long time until we figure out this whole genotype/phenotype
thing, not to mention the mechanisms by which the two are linked. For
the time being, I feel like reading SNPs is more like reading teacups
and omens than anything else, waving fancy statistical tools rather
than dead roosters...

I also gave the original publication on the association another read. And to me it also looks like it most likely is a statistical artefact. Nevertheless: It bugs me that they can get a study published which finds an association without even stating which allele should be the "risk" variant. I started a perfect pitch-genotype on openSNP as doing GWA with too small sample sizes seems to be en vogue: http://opensnp.org/phenotypes/119

Cheers,
Bastian   

Bastian Greshake

unread,
Jun 21, 2012, 5:26:11 AM6/21/12
to diy...@googlegroups.com
Hey,

On 21 June 2012 03:06, Simon Quellen Field <sfi...@scitoys.com> wrote:
Thanks -- that's a lot more than I knew before.

However, knowing that it produces a protein that interacts with a cancer gene is
information, but that bit of information adds little to our knowledge of how it might
affect absolute pitch.

Was there any hint as to a mechanism given in the paper? 

Nope, and most associations which are found have no mechanistic background at all. GWAS mainly work because of population genetics, specifically through Linkage Disequilibrium. So you find associations in polymorphic sites together with your phenotype, just because the associated SNP is in vicinity to the gene/genetic variation which causes the effect (either this, or it's just a false positive ;)). As the AP study only sampled a small number of SNPs it's even more unlikely that the SNP (or even the gene next to the SNP) has any mechanistic effect.

Cheers,
Bastian

Cathal Garvey

unread,
Jun 21, 2012, 5:50:07 AM6/21/12
to diy...@googlegroups.com
I recall reading a new scientist review of the Asian/AP thing, with some evidence supporting the idea that it was the tonal nature of some Asian/Oriental languages that lead to widespread AP.

That is, while tone is used to indicate context in Eurasian languages, it's sometimes used to determine precise meaning in Asian languages, so getting to grips with tones at an early age is simply part is learning to speak/comprehend.

I don't, of course, know whether this is the case, and I'm afraid I don't have a reference, as I'm working from memory.

Simon Quellen Field <sfi...@scitoys.com> wrote:

--
Sent from K-9 Mail on Android

Jason Bobe

unread,
Jun 21, 2012, 6:58:35 AM6/21/12
to diy...@googlegroups.com
On Wednesday, June 20, 2012 3:51:22 PM UTC-4, Bastian Greshake wrote:

And from the OMIM-page: «Gregersen et al. (2001) surveyed 1,067 music students enrolled in music theory classes in the United States and found an overall AP rate of 12.2%, with a markedly increased rate of AP in Asian students (47.5%) compared to Caucasian students (9.0%).» - http://www.omim.org/entry/159300


Peter Gregersen's lab at the Feinstein Institute has an ongoing research study looking at Absolute Pitch, for those who think they may possess the trait or want to get tested for it:


It is also interesting to note that people who have absolute pitch also have a higher rate of synesthesia as well. 

At the last GET Conference we had a few vignettes on "exceptional human traits".  One of the co-investigators of the AP study above, Elena Kowalsky (also a professional musician), gave a live demonstration of the absolute pitch trait which she has.  It was totally amazing.   She was blind folded.  I played an electronic piano such that when I punched a key the note would be displayed to the audience.  Immediately upon punching a key on the keyboard, Elena would identify the note.  The recognition was instant, no matter how fast I hammered at the keyboard or which key I punched.  I'll be publishing the video online shortly...and will post it here when it is live. 

Another "exceptional human trait" we explored at the conference was prosopagnosia or face blindness w/ Ken Nakayama:

Jason

Reply all
Reply to author
Forward
0 new messages