Sequenced Carolina GFP plasmid

36 views
Skip to first unread message

Avery louie

unread,
May 16, 2013, 2:27:33 AM5/16/13
to diy...@googlegroups.com, diyb...@diybio.eu, diybio...@googlegroups.com
For those of you wondering "what the heck is in that plasmid anyways", I had the pGREEN plasmid from Carolina sequenced with M13 forward with m13 reverse.

When BLAST-ed it comes up as: "Cloning vector pGFP, complete sequence"

here is the sequence:

GGGCGANTCGAGCTCGGTACCCGGGGNNCCGACGCGT
GGATCCTCAGTTGTACAGTTCATCCATGCCATGTGTAATCCCAGCAGCTG
TTACAAACTCAAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTC
GAAAGGGCAGATTGTGTGGACAGGTAATGGTTGTCTGGTAAAAGGACAGG
GCCATCGCCAATTGGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGC
TTCCATCTTCAATGTTGTGGCGGGTCTTGAAGTTCACTTTGATTCCATTC
TTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTATTC
CAATTTGTGTCCCAGAATGTTGCCATCTTCCTTGAAGTCAATACCTTTTA
ACTCGATTCTATTAACAAGGGTATCACCTTCAAACTTGACTTCAGCACGT
GTCTTGTAGTTGCCGTCATCTTTGAAGAAGATGGTCCTTTCCTGTACATA
ACCTTCGGGCATGGCACTCTTGAAAAAGTCATGCCGTTTCATATGATCCG
GGTATCTTGAAAAGCATTGAACACCATAGCACAGAGTAGTGACTAGTGTT
GGCCATGGAACAGGCAGTTTGCCAGTAGTGCAGATGAACTTCAGGGTAAG
TTTTCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAGAACTTGT
GGCCGTTAACATCACCATCTAATTCAACAAGAATTGGGACAACTCCAGTG
AAGAGTTCTTCTCCTTTGCTAGCCATCTTTAGTCTAGAGTCGACCCTAGA
GCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGNAATCATGG
TCATAGCTGTTTCCTGNGTGAAATTGNTATNCGCTCACAATTNCANNCNA
CATNCGAGCCGGANNCATAAANTGNAAAGCCTGGGGNGCC

Attached are the forward and reverse sequences for three samples.  the ones that are 116060 should be forward reads and 116108 should be reverse.
22928_1_05_15_13-001_116060_00.TXT
22928_1_05_15_13-001_116108_00.TXT
22928_2_05_15_13-002_116060_00.TXT
22928_2_05_15_13-002_116108_00.TXT
22928_3_05_15_13-003_116060_00.TXT
22928_3_05_15_13-003_116108_00.TXT

Dakota Hamill

unread,
May 16, 2013, 10:02:27 AM5/16/13
to diybio...@googlegroups.com
Very cool, thanks for providing that.  I've been looking for some raw sequence data to play around in BLAST with.

Avery louie

unread,
May 16, 2013, 3:14:43 PM5/16/13
to diybio...@googlegroups.com
You might also want to make contigs/align the sequences with clustal W/clustal omega.

http://www.ebi.ac.uk/Tools/msa/clustalo/

--A


On Thu, May 16, 2013 at 10:02 AM, Dakota Hamill <dko...@gmail.com> wrote:
Very cool, thanks for providing that.  I've been looking for some raw sequence data to play around in BLAST with.

--
You received this message because you are subscribed to the Google Groups "diybio-boston" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio-bosto...@googlegroups.com.
To post to this group, send email to diybio...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio-boston?hl=en.
For more options, visit https://groups.google.com/groups/opt_out.
 
 

Ian Hawkins

unread,
May 16, 2013, 3:32:58 PM5/16/13
to diybio...@googlegroups.com, diybio...@googlegroups.com
Anyone know if the Dermodex folliculorum or D. brevis nuclear genomes have been sequenced?

Thanks,
Ian Hawkins

ianfh...@yahoo.com

Sent from my iPad

Avery louie

unread,
May 16, 2013, 3:36:01 PM5/16/13
to diybio...@googlegroups.com
I checked here and didnt see anything : http://www.ncbi.nlm.nih.gov/genome

--A

Avery louie

unread,
Sep 8, 2013, 9:29:55 PM9/8/13
to diy...@googlegroups.com, diyb...@diybio.eu, diybio...@googlegroups.com
Which sequence is 900 bp?  It has been a while and I never really looked into it.  That said I definitely trust the sequence I have over Carolinas sequence.

--A


On Sun, Sep 8, 2013 at 12:56 AM, Maryam Saffarian <msa...@g.clemson.edu> wrote:
Hi,

I was wondering that sequence is for gfP or for gfp-lacZ? According to pGreen Carolina lab, mutant gfp fused to lacZ is around 600bp but the sequence above is 900bp. I am trying to design primers for the mutant gfp fused to lacZ.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/b921fb42-4bb3-426a-a29e-13ab22d282db%40googlegroups.com.
Reply all
Reply to author
Forward
0 new messages