Sequenced Carolina GFP plasmid

[Avery louie]

For those of you wondering "what the heck is in that plasmid anyways", I had the pGREEN plasmid from Carolina sequenced with M13 forward with m13 reverse.

When BLAST-ed it comes up as: "Cloning vector pGFP, complete sequence"

here is the sequence:

GGGCGANTCGAGCTCGGTACCCGGGGNNCCGACGCGT
GGATCCTCAGTTGTACAGTTCATCCATGCCATGTGTAATCCCAGCAGCTG
TTACAAACTCAAGAAGGACCATGTGGTCTCTCTTTTCGTTGGGATCTTTC
GAAAGGGCAGATTGTGTGGACAGGTAATGGTTGTCTGGTAAAAGGACAGG
GCCATCGCCAATTGGAGTATTTTGTTGATAATGGTCTGCTAGTTGAACGC
TTCCATCTTCAATGTTGTGGCGGGTCTTGAAGTTCACTTTGATTCCATTC
TTTTGTTTGTCTGCCATGATGTATACATTGTGTGAGTTATAGTTGTATTC
CAATTTGTGTCCCAGAATGTTGCCATCTTCCTTGAAGTCAATACCTTTTA
ACTCGATTCTATTAACAAGGGTATCACCTTCAAACTTGACTTCAGCACGT
GTCTTGTAGTTGCCGTCATCTTTGAAGAAGATGGTCCTTTCCTGTACATA
ACCTTCGGGCATGGCACTCTTGAAAAAGTCATGCCGTTTCATATGATCCG
GGTATCTTGAAAAGCATTGAACACCATAGCACAGAGTAGTGACTAGTGTT
GGCCATGGAACAGGCAGTTTGCCAGTAGTGCAGATGAACTTCAGGGTAAG
TTTTCCGTATGTTGCATCACCTTCACCCTCTCCACTGACAGAGAACTTGT
GGCCGTTAACATCACCATCTAATTCAACAAGAATTGGGACAACTCCAGTG
AAGAGTTCTTCTCCTTTGCTAGCCATCTTTAGTCTAGAGTCGACCCTAGA
GCTTTTGTTCCCTTTAGTGAGGGTTAATTTCGAGCTTGGCGNAATCATGG
TCATAGCTGTTTCCTGNGTGAAATTGNTATNCGCTCACAATTNCANNCNA
CATNCGAGCCGGANNCATAAANTGNAAAGCCTGGGGNGCC

Attached are the forward and reverse sequences for three samples.  the ones that are 116060 should be forward reads and 116108 should be reverse.

[Koeng]

Thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you thank you 

I have been looking for this sequence for a long long time. Just in time for a class I am doing on monday with this plasmid, thanks a ton!

-Koeng

[Koeng]

Wait a second, I automatically annotated the sequence with some software I had.... and it has a lac operator..... I am confused

On Wednesday, May 15, 2013 11:27:33 PM UTC-7, Avery wrote:

[Avery louie]

I imagine it might be in the pUC18 backbone, which has blue-white screening and therefore a (now broken) lac fragment?  I cant say for sure though, I just have those sequences.

--A

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at http://groups.google.com/group/diybio?hl=en.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/1216b042-87d0-437b-b9cb-8f14b323a844%40googlegroups.com?hl=en.

For more options, visit https://groups.google.com/groups/opt_out.
 
 

[Cathal Garvey (Phone)]

Yea, huge kudos Averie! Thanks for sharing this. :)

--
Sent from my Android phone with K-9 Mail. Please excuse my brevity.

[Cathal Garvey (Phone)]

What's the sequence of the supposed LacO? It's possible it's a holdover from whatever plasmids were used to construct pGreen, but also possible it's just noise. LacO isn't so big that pseudo-lacO sites couldn't appear by chance..

[Koeng]

The software I have actually has this vector sequence xD

the lac operator sequence is TTGTGAGCGGATAACAA. Both this and pUC19 have this sequence. Strange that it doesn't work...

Looking at the sequence, I see the multiple cloning site before GFP. Also the GFP doesn't start where it should, it starts with the atg in the M13 reverse primer... CAGGAAACAGCTatgAC, which is in frame with GFP. So I am thinking that they may have meant for these sequences  to interfere with GFP, and then once you clone something the GFP can be expressed..... But it obviously didn't work out that way

This is a weirdo vector.

[Jeswin]

so this is the whole plasmid sequenced? What did you guys use to
stitch it together into one sequence?

> --
> -- You received this message because you are subscribed to the Google Groups
> DIYbio group. To post to this group, send email to diy...@googlegroups.com.
> To unsubscribe from this group, send email to
> diybio+un...@googlegroups.com. For more options, visit this group at
> https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups
> "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at http://groups.google.com/group/diybio?hl=en.
> To view this discussion on the web visit

> https://groups.google.com/d/msgid/diybio/2b294a88-3f18-475d-b69e-c7e716e0c62a%40googlegroups.com?hl=en.

[Avery louie]

This is just the bit with gap in it.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CAAhF0R%2Bpnbu8F-qUFrR_KZBQjcSCYm-3pgmqq4R6o%3D3%2B7nP9Hw%40mail.gmail.com?hl=en.

[Tom Randall]

Nice sequence. I also had sequenced pGreen a couple years ago. Our sequences agree except for a few mismatches at the 5 and 3' ends, probably due to bad sequence calls/quality.
Mine can be found here: http://www.roningenetics.org/Sequencing.html
Go to the bottom of the page under the heading "Sanger Sequencing". My consensus of the 4 chromatographs posted is the fasta file with the header "pGreen_consensus_seq" and at the very bottom there is an alignment of your sequence and mine. If you look through the patent for this (pdf on the website) the GFP insert is cloned into pBSSK, which is a blue/white vector, which should explain the lac sequence homology.
Tom

[Maryam Saffarian]

Hi,

I was wondering that sequence is for gfP or for gfp-lacZ? According to pGreen Carolina lab, mutant gfp fused to lacZ is around 600bp but the sequence above is 900bp. I am trying to design primers for the mutant gfp fused to lacZ.

On Thursday, May 16, 2013 2:27:33 AM UTC-4, Avery wrote:

[Avery louie]

Which sequence is 900 bp?  It has been a while and I never really looked into it.  That said I definitely trust the sequence I have over Carolinas sequence.

--A

--

-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.

Visit this group at http://groups.google.com/group/diybio.
To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/b921fb42-4bb3-426a-a29e-13ab22d282db%40googlegroups.com.

[Matt Lawes]

Maryam,

The sequence is from flanking M13 priming sites on each side, so you have gfp or fused gfp plus some extra vector sequence.

Push through BLAST program at NCBI and you should see which part of sequrnce is gfp....

>matt

Sent from my Verizon Wireless 4G LTE DROID

-----Original message-----

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/CAL4KOmhVan%2B-M7ryRmfxyaH2PbSru2vS0DxiicJGMn1MwzpsCA%40mail.gmail.com.

[Anthony Pelletier]

Thanks for the sequence

The plasmid has Lac O and it is functional.

The reason that you don't need to induce it is that E. coli typically only makes a few copies of the lac repressor per cell. With a high-copy plasmid, there are too many operator sites and most of them are unoccupied. 

I put this plasmid into XL1-blue, which has the constitutive repressor (LacI^q) on an F'. The GFP is repressed in that strain and should be inducible with IPTG. 

I'm planning to test that this week. 

I had one of my students do the transformation and we didn't have any amp/tet plates for it (The F' is maintained by Tet^r). Out of a few hundred not-so-green colonies, there were 3 bright green ones that had lost the F' and therefore the constitutive repressor. 

We're planning a series of labs looking at gene regulation and having the students "discover" the rare bright green colonies in the absence of inducer, then plan experience to figure out why. Let me know if anybody wants the procedure once we test it.

-tony