Paired end

[Perry]

Hi-

Does GNUMAP align paired end data (as opposed to only aligning them as
single end reads)?

[W. Evan Johnson]

For RNA-seq or DNA-seq? For the former: No. for the latter: Yes.

[Perry Ridge]

For the latter...looking at the gnumap website, I can't seem to find syntax
for that. I might be oblivious to it, if it's there could you point me to
it?

[W. Evan Johnson]

Map the reads single end, then I will give you a script to run that will combine the pairs (its really fast!) for DNA-seq. Then there will be one more step after this.

[Perry Ridge]

Awesome, thanks!

[zhangwe...@gmail.com]

Hi Evan,
May I have a copy of your script to combine the pairs? I'm also dealing with the paired end DNA-seq data.
So I have to first run GNUMAP for each end separately, then use your scripts, right?
Thanks~

[W. Evan Johnson]

CJ, 

Do you have any paired-end GNUMAP scripts to share?

Evan

--

---
You received this message because you are subscribed to the Google Groups "gnumap-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to gnumap-users...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Wenqian Zhang]

Hi Evan,

I have paired end DNA-seq data (from illumina platform, named as "test_1.fq.gz" and "test_2.fq.gz"). The format of two files is shown as follows:
@SRR796870.1 FCD0CDMABXX:5:1101:1210:2171 length=90
CCCTGAGTCAGGCACCGGGGATGANTGGTCCTCTCTCAGGAAGTCAAAGCCACCTGGTGGGAGAAGAAGGTCAAGGAGGGATGGACTAGG
+SRR796870.1 FCD0CDMABXX:5:1101:1210:2171 length=90
cececeee^ebd^Wab]a^`[S][B[[[[[eeeeeeddecWdddddd\cdeedeeeedeWRKXLYcc]Wcbdddda_VaURJ]PYcaWc_
@SRR796870.2 FCD0CDMABXX:5:1101:1236:2175 length=90
CAGGGGGCCAGGAGCCATAGGAAGCCCAAGGGAATCCACACCAGAACAGTTTGCTCAAAACAAAGTGGCAGGGGTGGCTCCCGACCGTCC
+SRR796870.2 FCD0CDMABXX:5:1101:1236:2175 length=90
ggfggedgggggegggcgbgdggfgffafdcbbacgcgfagggdegebdadaefedad^ce]dZa[dced`^BBBBBBBBBBBBBBBBBB

I only have fq files as inputs and want to do mapping and SNV calling.

How to do mapping with PE reads, option (1) or option (2)?

(1).
gnumap -g ref.fa -o test.1.out --illumina -v 1 -m 12 -j 10 -h 100 -a .95 -p -c 8 test_1.fq.gz
gnumap -g ref.fa -o test.2.out --illumina -v 1 -m 12 -j 10 -h 100 -a .95 -p -c 8 test_2.fq.gz

then use your scripts to deal with test.1.out and test.2.out? May I have a copy?

(2).
gnumap -g ref.fa -o test.out --illumina -v 1 -m 12 -j 10 -h 100 -a .95 -p -c 8 "$(echo `ls ./test*.fq.gz` |sed -e 's/ /,/g')"

Can the output be used for SNV calling directly? Or some other processes are needed before SNV calling?

Thanks~

Wenqian

--

---
You received this message because you are subscribed to a topic in the Google Groups "gnumap-users" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/gnumap-users/QogeLO3_So0/unsubscribe.
To unsubscribe from this group and all its topics, send an email to gnumap-users...@googlegroups.com.

[tzfif...@gmail.com]

Hello,

I'd also like to map paired end (DNA) as far a I understand I should: 

map R1, map R2, then connect the pairs with a script;

can I see the script, please?

thank you, best, Tomaž