Fastq-mcf behavior on different operating systems

[Eugenia Golovina]

I run fastq-mcf on the same file but on different operating systems (MacOS X Yosemite, version 10.10.2 and Linux Ubuntu 12.0.4) and got different output files. It seems to me, on Linux, fastq-mcf works incorrectly, because I still see TCGTATGCCGTCTTCTGCTTG adaptor sequence in the output (but it was specified in adaptors file).

Please, help me to understand why it happens.

[Erik Aronesty]

Can you post the first two lines of output from 

fastq-mcf -h

run on both operating systems?

And the exact command used.

Also, if it's ok, can you post a sample of the files used?

fastq-mcf does not attempt to eliminate presence of adaptor.   It does adaptor contamination edge-trimming.  Not alignment/removal.   And in many instances it will not remove adaptor at all (if it is rare, for example), because when adaptors are rare, false-positive trimming will then outweigh true-positive.

[Eugenia Golovina]

Sure! I've been making some tests for several apps. That's why input is very small, just 10 reads. I found the same for large files.

Input file: long_basespace_phred33_10_reads.fq
output files: mac_trim_adaptors_long_basespace_phred33_10_reads.fq (Mac OS) and ubuntu_trim_ad_long_reads.fq (Ubuntu)
adaptors list: adaptors.fasta

1. the first two lines of output from fastq-mcf -h:

Mac OS:
""usage: fastq-mcf [options] <adapters.fa> <reads.fq> [mates1.fq ...] ""

Ubuntu: 
""usage: fastq-mcf [options] <adapters.fa> <reads.fq> [mates1.fq ...] ""

2. the exact command used on both Mac OS and Ubuntu: 

""fastq-mcf -t 0.0001 -l 15 -o mac_trim_adaptors_long_basespace_phred33_10_reads.fq adaptors.fasta long_basespace_phred33_10_reads.fq""

--
You received this message because you are subscribed to a topic in the Google Groups "EA Utils" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/ea-utils/K8xcGXAVYZs/unsubscribe.
To unsubscribe from this group and all its topics, send an email to ea-utils+u...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

--

Best regards, 

Evgeniia Golovina

Email: eug...@genestack.com

Mobile: +79312477567

Skype: Foffa_Golovina

[Eugenia Golovina]

2. the exact command used on both Mac OS and Ubuntu:

""fastq-mcf -t 0.0001 -l 15 -o mac_trim_adaptors_long_basespace_phred33_10_reads.fq adaptors.fasta long_basespace_phred33_10_reads.fq""

""fastq-mcf -t 0.0001 -l 15 -o ubuntu_trim_ad_long_reads.fq adaptors.fasta long_basespace_phred33_10_reads.fq""

[Erik Aronesty]

I expec the fiurst two lines of output to be something like this:

Usage: fastq-mcf [options] <adapters.fa> <reads.fq> [mates1.fq ...]
Version: 1.04.636

On Tuesday, February 24, 2015 at 5:37:29 AM UTC-5, Eugenia Golovina wrote:

[Eugenia Golovina]

Unfortunately, I don't see tool version. Just empty string. 

I took it from https://ea-utils.googlecode.com/files/ea-utils.1.1.2-537.tar.gz

[Eugenia Golovina]

I can try to reproduce it on other ea-utils version.

--

You received this message because you are subscribed to a topic in the Google Groups "EA Utils" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/ea-utils/K8xcGXAVYZs/unsubscribe.
To unsubscribe from this group and all its topics, send an email to ea-utils+u...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Erik Aronesty]

thats a pretty old version, you might want to build from source, or download from here:

https://drive.google.com/folderview?id=0B7KhouP0YeRAOTFWWGVFYkFSQjg&usp=sharing

On Tuesday, February 24, 2015 at 10:28:56 AM UTC-5, Eugenia Golovina wrote:

I can try to reproduce it on other ea-utils version.

On Tue, Feb 24, 2015 at 6:10 PM, Eugenia Golovina <eug...@genestack.com> wrote:

Unfortunately, I don't see tool version. Just empty string. 

I took it from https://ea-utils.googlecode.com/files/ea-utils.1.1.2-537.tar.gz

On Tuesday, February 24, 2015 at 6:05:47 PM UTC+3, Erik Aronesty wrote:

I expec the fiurst two lines of output to be something like this:

Usage: fastq-mcf [options] <adapters.fa> <reads.fq> [mates1.fq ...]
Version: 1.04.636

On Tuesday, February 24, 2015 at 5:37:29 AM UTC-5, Eugenia Golovina wrote:

I run fastq-mcf on the same file but on different operating systems (MacOS X Yosemite, version 10.10.2 and Linux Ubuntu 12.0.4) and got different output files. It seems to me, on Linux, fastq-mcf works incorrectly, because I still see TCGTATGCCGTCTTCTGCTTG adaptor sequence in the output (but it was specified in adaptors file).

Please, help me to understand why it happens.

--
You received this message because you are subscribed to a topic in the Google Groups "EA Utils" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/ea-utils/K8xcGXAVYZs/unsubscribe.

To unsubscribe from this group and all its topics, send an email to ea-utils+unsubscribe@googlegroups.com.

For more options, visit https://groups.google.com/d/optout.