trouble with lentiCRISPR v2

[Brett Peterson]

Hi all,

I was wondering if anybody else was struggling with getting KO in mammalian cell culture with the lentiCRISPR v2 construct? I'll explain my problem:

My polyclonal cell lines are resistant to puro, they express Cas9 (visualized by western blot - so I know the construct is being expressed), but I see no knockdown in my gene of interest. The obvious culprit is the quality of the guides, however I've had excellent success with these guides in the pX462 (Cas9n expressing) construct. I'm confused because the lentiCRISPR v2 construct should, in theory, be more efficient than pX462 as it is being stably expressed and the WT Cas9 requires a single sgRNA for cutting, whereas the pX462 is only a transiently expressed construct expressing the Cas9 nickase which requires 2 sgRNAs spaced by "x" number of bases. However, the same guides that result in completely KO in at least 40% of monoclones when used in the pX462 system, do not touch my gene of interest when stably incorporated into the same parental cell-line using lentiCRISPR v2. Also, all of the constructs have been sequence verified - so there aren't any cloning issues.

If anybody has any ideas, or if there's something I'm completely missing, I'd appreciate the insight.

Thanks in advance,

Brett

[Neville Sanjana]

Hi Brett,

Sorry to hear about your troubles. That sounds very strange.... in my hands, lentiviral CRISPR always results in higher indel rates due to the constitutive expression. The only thing I can think of is that there might be some recombination or other cloning issue that has affected the U6 sgRNA cassette in the lenti vector. This would explain why you still get expression of Cas9 and the puro resistance gene. Perhaps you can try sequence the U6 cassette to verify that the U6 promoter and sgRNA guide and scaffold are intact.

Hope that helps,

Neville

--
You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.
To post to this group, send email to cri...@googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Brett Peterson]

Hi Neville,

Thanks for the quick response. I agree that a problem with the U6 promoter would make sense. What sequencing primer would you use to sequence the U6 cassette, sgRNA, and scaffold/ and about how long of a sequencing read would that be?

Thanks again for your help!

Brett

[Neville Sanjana]

Hi Brett,

Here's a sequencing primer that I've used before which binds in the cPPT lentiviral element (and thus can be used to sequence in most lenti vectors):

GGTACAGTGCAGGGGAAAGA

Sequence cPPT F

In a typical Sanger sequencing read (e.g. standard sequencing) of 700 - 1000 bp, you should capture the entire sequence for the hU6 promoter (250 bp) and the sgRNA guide and scaffold (100 bp right after hU6). 

In lentiCRISPRv2, you will probably also see in the same read most of the EFS promoter that drives Cas9 and Puro expression.

Best wishes,

Neville

--

[Manuel Kaulich]

Hi Brett,

How many different gRNA sequences are you using simultaneously to induce the KO?

We, and others, have consistently seen problems in generating full KOs with a single gRNA sequence. Which is why we use a pool of 3 high quality sequences.

Best,
Manuel

[Daniele Gilkes]

Hi Manuel and others
When you use multiple guide sequences do you put them in tandem into the lenticrisper V2 vector. We are new to this and designed 5 gRNAs and independently cloned them into the v2 crisper but only one seemed to give an acceptable KD of 80%. The rest were at 50%. I guess we could use 2 viruses.

Is it acceptable to confirm KD with real-time PCR and Westerns or do we need to assess the genomic DNA?

thank you

from a newbie!!

[Brett S Peterson]

Hi Daniele,

I'm not sure about the cloning, but as far as confirming KD goes, there are a few things to consider:

1) what question are you trying to answer using the system? If you're interested in the phenotype in the absence of your protein, I would argue that a WB is all you should be concerned about. However, reviewers may require some genomic sequencing to confirm the nature and location of the indel. This being said, I don't know what you can expect from sequencing a polyclonal population of cells, because in theory, the nature of the indel could be different in every cell within the population, and also be in flux as the constitutive expression of both the chimeric RNA and Cas9 should always be cutting - something that I'm still struggling to reconcile. This is why I typically side with protein expression.

2) real-time PCR (assuming you're talking about mRNA expression - there is some literature indicating that you can detect indels based on shifting melt curves). The only time you would expect a decrease in mRNA expression using CRISPR/Cas9 is if the Nonsense Mediated Decay (NMD) occurring. In my hands (using a different CRISPR vector) NMD does not always occur. I've completely knocked out genes at the level of protein while the mRNA remains untouched, and I've also knocked out different genes that result in a 90% reduction in mRNA (which I've attributed to the activation of NMD). Ultimately, no change in mRNA does NOT mean that you haven't knocked-out the protein.

The Google group/community can correct me if I'm wrong, but this is how I understand the system.

Hope that is somewhat useful!

Brett

--
You received this message because you are subscribed to a topic in the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/crispr/-YxRHXCxDkY/unsubscribe.
To unsubscribe from this group and all its topics, send an email to crispr+un...@googlegroups.com.

[Alan Schoenfeld]

Brett,

I too have experienced the same phenomenon.  We have been trying to independently KO 3 different genes using LentiCRISPR v2, each with 3 different sgRNA sequences (designed on the MIT site).  With one gene, we used a pool of the 3 viruses, all with no luck.  I was wondering if you did sequence and see a mutation/rearrangement of the U6 sgRNA cassette.  I was thinking that rather than a rearrangement, that perhaps there is epigenetic silencing of the U6 promoter, which would not affect the expression of the puro resistance cassette.  If so, it may be better to use separate plasmids for the sgRNA and Cas9.  I am wondering if anyone has compared the effectiveness of LentiCRISPR (v2) to that of a 2 plasmid system?  The thought of having to reclone the sgRNA sequences bothers me, but if it works better in the long run, it may be worth it.

Alan

On Friday, January 15, 2016 at 4:52:40 PM UTC-5, Brett Peterson wrote:

[Neville Sanjana]

Hi Alan,

LentiCRISPRv2 is comparable (or slightly better) in efficacy to lentiGuide-Puro (2-vector system) after puromycin selection (see Supp Figure 1 of our Nature Methods 2014 paper). 

If you suspect recombination might be an issue, I recommend doing a diagnostic digest of your plasmid. Typically, the rearrangements we see after bacterial recombination result in a much smaller plasmid size. Here is a link to a vector map for lentiCRISPRv2 to find what enzymes cut in it: http://bit.ly/lentiCRISPRv2

Hope that helps,

Neville

--

You received this message because you are subscribed to the Google Groups "Genome Engineering using CRISPR/Cas Systems" group.

To unsubscribe from this group and stop receiving emails from it, send an email to crispr+un...@googlegroups.com.

[hzsh...@sina.com]

Hi Manuel,

In my case, I already tried more than 10 guide RNAs designed based on the MIT website. None of them can KO my gene of interest in certain cell lines by surveyor assay. I have to rethink about efficacy of crispr-cas9 system.

So do you have similar problem?

Regards,

Zong

Op maandag 18 januari 2016 09:09:47 UTC+1 schreef Manuel Kaulich:

[Donghee Lee]

Hi Brett

It's been a long time, but did you get to the conclusion of lentiCRISPRv2 issue?

Thanks

Donghee

2016년 1월 17일 일요일 오전 7시 16분 17초 UTC+9, Brett S Peterson 님의 말: