PCR trouble

[David Ishee]

I'm trying to amplify the LuxC-LuxG (or LuxC-LuxE) section of pVIB (pJE202).

This is the forward primer
CATATG ATGAATAAATGTATTCCAATGA I added the Ndel sequence to the 5' end

This is the reverse primer
CTCGAG TTATACGTATGCAAAAGCATCGG I added the Xhol sequence to the 5' end

I also tried a different primer made to bind LuxE but I don't have its sequence with me I can get it when I get home.

I'm consistently getting some small product when I run it on a gel with both primer combinations. On the gel it's smaller than 1kb and very bright. I've done a lot of variations with time, temp concentration, template purity etc. I've made fresh working stock (though my original dilution make still be contaminated if that's the issue) I plan to run a PCR of each primer alone and in combination with no template and see if I still get that same product.

Since I don't have a sequence for the plasmid I'm using I'm using the V. Fischeri genomic sequence from gene bank for the Lux gene sequence. The one submitted by Thomas Knight.

Does anyone see any mistakes in my primer design or elsewhere?

[Tom Knight]

You don’t say what your PCR conditions were. This is a long fragment, about 6400 bp, and will require a long extension time. The primers should amplify, but if you are planning on cutting with NdeI and XhoI following PCR, then you need to extend the primers with at least 3-4 bp of junk sequence that can be cut off by the restriction enzyme. Enzymes don’t like to act well at the very end of dsDNA linear fragments. For the PCR to be successful, you’ll need extension times of at least 6 minutes/cycle for normal enzymes, and at least 3 minutes/cycle even with a fast enzyme such as Phusion or Q5.

You should also be aware that there is an NdeI site and an XhoI site in the middle of the luxA CDS, which means you won’t be able to clone with those enzymes without additional work.

> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at https://groups.google.com/group/diybio.
> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/d220c0e8-cf94-4775-999b-5fb3c8b9c167%40googlegroups.com.
> For more options, visit https://groups.google.com/d/optout.

[David Ishee]

My PCR conditions are

95 for 5 minutes

95 for 30 seconds
52 for 45 seconds
68 for 6 minutes and 30 seconds
30 cycles of that

68 for 5 more minutes

Thanks for the correction about the restriction sites. I'll add some junk to the 5' end.

[Scott]

Are you linearizing the plasmid with an enzyme that cut outside of your target before you amplify? The backbone of pVIB is pBR322. You can get more details on how it is put together here. 

Yes, Tom is correct on adding 4-5bp of sequence at the 5' end of your primers. Some enzymes just don't cut well at the end. NEB has a table on what enzymes cut well close to the end. 

Cheers,

Scott

[David Ishee]

No I'm using Plasmid from a miniprep as my template.

I'm also using a premade Taq Master mix and 1pmol per uL of each primer in the final reaction. My reactions are 25uL and I'm doing them on a plate.

Also Tom, I did see those other sites in the section I want, I have a long convoluted plan to put everything back together, hopefully that works better than my PCR so far.

[David Ishee]

The second reverse primer I tried was

CTCGAG
TTAATCCTTGATATTCTTTTG

That was a reverse primer made for LuxE

I made the same mistake with the restriction site added to the end.

[Dakota Hamill]

Perhaps I'm not caught up on the thread but shouldn't your primers be in micromolar concentrations?  At the least a few hundred pico

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/8bed0d89-3d6b-4491-8051-397c7c885eb8%40googlegroups.com.

[David Ishee]

I could easily have made a mistake in my math or in my dilution.

In the original primers I received from IDT I diluted them 10 times the nmol on the tube so

[Dakota Hamill]

I usually always get them at the normal 100um conc. Do a 1 to 10 to get to 10um working. Then maybe 1ul per primer in rxn.  Your primer conc. sounds low

On Mar 1, 2016 9:37 PM, "David Ishee" <midgard...@gmail.com> wrote:

I could easily have made a mistake in my math or in my dilution.

In the original primers I received from IDT I diluted them 10 times the nmol on the tube so

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/90d73051-b77d-448c-9b1c-7bc1b7dd08d5%40googlegroups.com.

[David Ishee]

23.8 nmole was diluted in 238 uL of water
Then I diluted 5uL of that in 50uL of water

Then I used 2.5uL in my 25uL reaction.

I've also done different dilutions with the same but all 0.001 nmole per uL or less.

I'm also getting very bright bands even with that diluted 1000 more times.

[Dakota Hamill]

Very bright bands of primer dimer or your template\plasmid or your product?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/8f1fd056-15a2-44cd-8933-088900bfd08c%40googlegroups.com.

[David Ishee]

I don't know, it's less that 100 bp dimers are possible. My target and product would be much bigger.

[Dakota Hamill]

Your dilution looks fine.

Less than 100bp is usually primer dimers.  Check your annealing temp, make sure you have enough template.  As Tom said you do have a pretty big amplicon, so it might take some fine tuning.  

Could you post a picture of your gels?

You know your miniprep worked?

On Tue, Mar 1, 2016 at 9:55 PM, David Ishee <midgard...@gmail.com> wrote:

I don't know, it's less that 100 bp dimers are possible. My target and product would be much bigger.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/11a13ed3-01fa-4354-a075-8e38e81dce46%40googlegroups.com.

[David Ishee]

I had to switch to my PC I didn't see an option to attach an image from my phone.

Would you recommend I raise or lower the annealing temp? 

I can try some variations on elution volume, but I don't have a way to measure plasmid density in my elution. I have done transformations successfully with good efficiency with my minipreps. Yesterday I took the remainder of the miniprep and added gelgreen to it then compared it to elution buffer without plasmid but with an equal concentration of gelgreen. The plasmid elution has clear florescence. I feel comfortable that my mini preps are working.

This is how the gels typically look, that's a 1Kb ladder in the left most well.

[David Ishee]

One thing about my mini preps is I tend to still have some ethanol contamination in my elution. It's usually enough I can run a miniprep on a gel because it won't sink.

[Dakota Hamill]

Could you label what's in each lane?

A dirty miniprep and residual ethanol can affect PCR.

I've always found template DNA quality to have much more of an impact on PCR success rate vs annealing temp.  I've had the same primers anneal from 48C all the way up to 60C fine.

If you have a mini-prep, you should have enough to run just your plasmid + your plasmid cut with restriction enzymes.  

Run just your plasmid on a gel, and run your plasmid cut with a restriction digest.  

On Tue, Mar 1, 2016 at 11:15 PM, David Ishee <midgard...@gmail.com> wrote:

One thing about my mini preps is I tend to still have some ethanol contamination in my elution. It's usually enough I can run a miniprep on a gel because it won't sink.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/802d3990-174a-4ad7-a5e7-cc1c9feaf007%40googlegroups.com.

[David Ishee]

In that particular gel I was testing primer dilution so they are the same setup except the second well from the left is 100x dilution then 250x then 500x and 1000x dilution. I was testing to see if my primers were too concentrated.

The left most well is a 1kb ladder

I've also run PCR with plasmid bearing bacteria as the template and not a miniprep with the same results.

I'll keep working of tweaking the procedure to get the ethanol out of my minipreps they usually float away when I try to load them into a well. I've tripled the drying time in the centrifuge, maybe I'll just let the spin column sit in the tube and dry 10 minutes for before eluding.

[Dakota Hamill]

If the volumes you listed before are correct you have a final concentration of 1uM primers which is fine.

I've not checked your primer sequences so I don't know if they actually anneal to anything in your target.  Did you design them yourself?  Get them from a paper?

Run a few microliters of your miniprep and you should see your plasmid, make sure it's cleaned up well.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/4917307d-8e49-4082-84e7-42495b632f1d%40googlegroups.com.

[Scott]

David,

If you don't have access to a uv spec then you can cut your plasmid as Dakota suggested. Use enzymes that give you a fragment size similar to your expected pcr product - 6400bp. For example, XbaI/EcoRV will liberate a 6,593bp fragment based on Tom's sequence - AF170104 (don't use this cut as pcr template!). Run it with a known amount of 1kb ladder. You can estimate how much each run of the ladder is based on how much you add. See the manufacturer's instructions. This will give you an estimate of how much DNA you have. 

Yes, evaporate the ethanol. It will cause problems for you!

XbaI looks unique in the plasmid so I would cut your template with that first before doing the PCR. It doesn't fall within your target.

Dakota, the primers do look right compared to Tom's sequence.

Cheers,

Scott

[David Ishee]

I designed them myself, my first try at primer design, so it's very possible that it's a design issue.

I'll get my mini preps to a clean enough point to run one with a digest as well.

[Scott]

David,

I like to have a G or C at the 3' end of my primers (habit) but I looked at your primers and I don't see hairpins. Given you are using a plasmid as template, what you have should be fine.

Also, earlier you mentioned you were using Taq which isn't a high fidelity enzyme. You run the risk of introducing errors. Pfu is better or if you can afford it try Q5 or Phusion from NEB.

Cheers,

Scott

[Tom Knight]

The primers bind correctly to the appropriate regions.

A few things:
You should get some NEB 2-log ladder to replace the ladder you are using. It has bands down to 100 bp and will make interpretation much easier.
Also, you can run your gels much longer.

Your problem is likely one of two things:
1) Far too much template. This is a common error. PCR can amplify (in principle) a single molecule. You need vanishingly small amounts of template. Plasmid DNA preps often contain many inhibitors of PCR reactions such as ethanol or SDS. I’d strongly suggest doing serial dilutions of your template DNA down to 1:1000 and adding 1 ul of the result as template. This eliminates most of the inhibitors and leaves sufficient template. Or, you can do colony PCR with cells. Barely touch a colony with a fine tip then swirl the tip in 50 ul of water, scraping it on the tube edge. Change tips, use 1 ul of this as a template. Your initial denaturing should be sufficient to lyse the cells. Remember — less is more.

2) Your extension may still not be long enough. Pure Taq has problems with long templates. I’d definitely switch to Q5. I would get the master mix and not fool with separate buffer/enzyme/magnesium. The manufacturers know what they are doing in making these master mixes, and it is one fewer thing to screw up in pipetting. Q5 will allow a much shorter extension time. Don’t forget to follow instructions on the cycling conditions, which are quite a bit different from Taq.

> On Mar 2, 2016, at 12:

> 30 AM, David Ishee <midgard...@gmail.com> wrote:
>
> I designed them myself, my first try at primer design, so it's very possible that it's a design issue.
>
> I'll get my mini preps to a clean enough point to run one with a digest as well.
>

> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at https://groups.google.com/group/diybio.

> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/53d0a220-6bf8-46a7-bbe0-4c6d7aeb0e96%40googlegroups.com.

[David Ishee]

I'll look into getting some more specialized Enzymes, and I'll do the template dilution in the mean time along with another 30 seconds of extension time.

[Dakota Hamill]

NEB has sample packs of fusion and other high fidelity enzymes you can get, check their website

On Mar 2, 2016 1:53 PM, "David Ishee" <midgard...@gmail.com> wrote:

I'll look into getting some more specialized Enzymes, and I'll do the template dilution in the mean time along with another 30 seconds of extension time.

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/f57b1264-a739-4e56-9f08-659b7386ac7d%40googlegroups.com.

[David Ishee]

Awesome I will

[David Ishee]

Okay I'm getting a sample of Q5 sent to me but it's just the enzyme, what would be the simplest and cheapest way to ready that.

Could I add a bit to my existing master mix?

[Tom Knight]

I’d be shocked if they did not include buffer with the enzyme. Use it.

> On Mar 2, 2016, at 4:45 PM, David Ishee <midgard...@gmail.com> wrote:
>
> Okay I'm getting a sample of Q5 sent to me but it's just the enzyme, what would be the simplest and cheapest way to ready that.
>
> Could I add a bit to my existing master mix?
>

> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at https://groups.google.com/group/diybio.

> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/0b994bf1-bfa9-4ad1-a2e7-d0b7b5b8eef9%40googlegroups.com.

[David Ishee]

Okay

[Koeng]

I believe that they do not include NTPs, might have to add that

On Wednesday, March 2, 2016 at 2:27:35 PM UTC-8, David Ishee wrote:

Okay

[David Ishee]

I ran several reactions with 7.5 minutes of elongation per cycle. Also tried several dilutions of my miniprep, I ran a 1x 100x 500x and 1000x dilution. I also ran the plasmid in the gel with a XhoI digest. The digest didn't show up on the gel at all, the uncut plasmid made the right band, and I got the same small product on the dilutions as before except for the 500x which had no band.

So it looks like the template was present, the dilutions didn't affect it or the extra extension time. I'll be running it again once the Q5 gets here on Monday. It does come with buffer I asked. I'm not sure if that's all I'll need though.

[David Ishee]

This link may get you to the picture of the gel.

https://m.facebook.com/story.php?story_fbid=1557187284594009&id=100009082563348&ref=m_notif&notif_t=group_comment_reply#!/photo.php?fbid=1557187271260677&id=100009082563348&set=a.1471089689870436.1073741828.100009082563348&source=57&refid=52&ref=m_notif&notif_t=group_comment_reply&_ft_=top_level_post_id.1557187284594009%3Atl_objid.1557187284594009%3Athid.100009082563348&__tn__=E

[Dakota Hamill]

picture link doesn't work

On Sat, Mar 5, 2016 at 6:15 PM, David Ishee <midgard...@gmail.com> wrote:

This link may get you to the picture of the gel.

https://m.facebook.com/story.php?story_fbid=1557187284594009&id=100009082563348&ref=m_notif&notif_t=group_comment_reply#!/photo.php?fbid=1557187271260677&id=100009082563348&set=a.1471089689870436.1073741828.100009082563348&source=57&refid=52&ref=m_notif&notif_t=group_comment_reply&_ft_=top_level_post_id.1557187284594009%3Atl_objid.1557187284594009%3Athid.100009082563348&__tn__=E

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/8004a023-0339-45d9-b3f0-9b6d8ac123e0%40googlegroups.com.

[Dakota Hamill]

http://tmcalculator.neb.com/#!/

try that.

could try some DMSO or something to

[David Ishee]

What does DMSO do for it I have some. How much would I use?

[Dakota Hamill]

I havn't used it in PCR in a while.  I'm sure NEB, Google, or someone else on here could give you a more specific concentration.  It can help with tough PCR.

https://www.neb.com/protocols/2012/06/01/guidelines-for-pcr-optimization-with-phusion-high-fidelity-dna-polymerase

On Sat, Mar 5, 2016 at 7:42 PM, David Ishee <midgard...@gmail.com> wrote:

What does DMSO do for it I have some. How much would I use?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/03ef4d6e-7643-49b7-86ca-37345a1c9630%40googlegroups.com.

[Dakota Hamill]

That's an old guide but there are many out there like it.  You could drop your annealing even lower.  To,bad you don't have a second set of primers that you could use as a control on pVIB

[Dakota Hamill]

Shot in the dark but drop annealing to 47c for 30 seconds, and increase denature to 98 for 45

[Dakota Hamill]

Do that as well as a 2nd run with 1uL DMSO in a 25uL reaction.

Sorry for the spam

[David Ishee]

Helpful advice is never spam. Thanks, I'll try those.

Also this link may work.

https://scontent-atl3-1.xx.fbcdn.net/hphotos-xpa1/t31.0-8/fr/cp0/e15/q65/12771519_1557187271260677_5649555760002433132_o.jpg?efg=eyJpIjoidCJ9

[Dakota Hamill]

AAAAAAAAAAnd one more.  Right now your primers are at 1uM final conc I believe.  Try dropping that in half.

Do things stepwise, or vary only one thing at a time, if you throw in 2 or 3 changes into one reaction and it works, you don't know why it works.

Also, are your gels being run in a Tupperware container or something?  I'd get new DNA ladder.  What % gel are you running and what are you using to run it?

Your gels are smiling and smearing, so either your gel is getting to hot because it's to high a voltage, or you have a crappy power supply.

What size is your product again?

What did you put in each of those wells?

[Dakota Hamill]

I commend you on actually trying the advice given here and with a fast turn-around to.  Keep at it, you'll jump for joy when you get it to amplify.  

[David Ishee]

From left to right it's

1kb ladder
100bp ladder
PVIB from miniprep
PVIB digest with XhoI

The next 4 are template dilutions

PCR with 1x template
PCR with 100x template
PCR with 500x template
PCR with 1000x template

Yes it is in tubber ware. My power supply is a bunch of 9volt batteries but I can vary the voltage.

[David Ishee]

https://scontent-atl3-1.xx.fbcdn.net/hphotos-xpt1/t31.0-8/fr/cp0/e15/q65/12710804_1551276741851730_3849832055315080991_o.jpg?efg=eyJpIjoidCJ9

My power supply

[David Ishee]

My setup and transluminator
https://scontent-atl3-1.xx.fbcdn.net/hphotos-xfp1/t31.0-8/fr/cp0/e15/q65/12622326_1543758029270268_8521023778670644268_o.jpg?efg=eyJpIjoidCJ9

[David Ishee]

A little better

https://scontent-atl3-1.xx.fbcdn.net/hphotos-xpa1/t31.0-8/fr/cp0/e15/q65/12778668_1557624907883580_883606189898718800_o.jpg?efg=eyJpIjoidCJ9

[Dakota Hamill]

I'm actually really surprised at how good that gel looks given the fact you have 20 9V batteries in series.  That thing must get hot if you're not controlling the current, which is also probably why the bands are smearing and curving at the edges..  Hahaha that is a true DIY setup if I've ever seen one, reminds me of the good ol' days.

The other question I have to ask now, after seeing that setup, what is your thermal cycler?  

On Sat, Mar 5, 2016 at 8:28 PM, David Ishee <midgard...@gmail.com> wrote:

A little better

https://scontent-atl3-1.xx.fbcdn.net/hphotos-xpa1/t31.0-8/fr/cp0/e15/q65/12778668_1557624907883580_883606189898718800_o.jpg?efg=eyJpIjoidCJ9

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/fc859528-bc37-4ccb-a134-424f804db272%40googlegroups.com.

[David Ishee]

I think the main thing controlling the current is the cheapness of the batteries and the amount of electrode surface in contact with the buffer. It actually stays cool even with 150v, and I get maybe 10 gels out of a bank of batteries.

This is my PCR machine

https://scontent-atl3-1.xx.fbcdn.net/hphotos-xpt1/t31.0-8/fr/cp0/e15/q65/12622378_1540136766299061_5737772239883873713_o.jpg?efg=eyJpIjoidCJ9

[Dakota Hamill]

Just to make sure - that thing doesn't have a heated lid, right?

You're using mineral oil?

It's not often the machine is the problem, but always good to check.

You're following good practice in setting up your PCR reactions and keeping things on ice until you're about to start?

--
-- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
Learn more at www.diybio.org
---
You received this message because you are subscribed to the Google Groups "DIYbio" group.
To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
To post to this group, send email to diy...@googlegroups.com.
Visit this group at https://groups.google.com/group/diybio.

To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/c95cb659-7d68-479a-8e12-8d2bd0dc252a%40googlegroups.com.

[David Ishee]

I am using mineral oil, and I am keeping it on ice until I put it in the machine.

[Scott]

Hi David,

Your gel electrophoresis kit is truly awesome. Seat of the pants DIYbio!

Have you PCR amplified anything using your PCR machine? Smaller fragments are easier to work with if you have no previous experience with PCR.

Also, what are your plans with the Lux PCR fragment once you amplify it?

Cheers,

Scott

[David Ishee]

Thanks

I did the PTC genotyping on myself and three others with great results each time, but it's a much smaller amplicon.

The plan is two part first I want to ligate it into the pDusk plasmid and try to get darkness activated bioluminescence, it'll be interesting to see how it reacts to its own light then. Depending on all the protein production and decay rates I may get glowing oscillator, or just something that glows dimly. Mostly this is practice for me to do PCR, restriction digest, PCR product purification, dephosphorylation, electrophoresis, and ligation, etc and all the design stuff along the way. That way I can do something challenging and make a bunch of mistakes and learn from them. Basically the labs I never had by not going to school.

I also plan to use those large fragments in a series of experiments to make a simplified and cheap protocol for sperm mediated gene transfer. Something that could be done in a lab space that costs less than $1000.

[David Ishee]

Okay, I have Q5 and Phusion now, I'll be trying both today.

[David Ishee]

No product on either one, but also no unexpected product.

It was probably my template, I was in a hurry and didn't use a miniprep, I tried to use a bit of the plasmid bearing bacteria. I'll try again with a fresh miniprep tonight.

[Tom Knight]

I’d strongly recommend that you debug this with ampllifying a shorter fragment — something around 500 bp. You can do this quicker and easier than with the challenging long PCR you are attempting. Make a simple one work, then you will know where the problems arise.
How confident are you in the sequence of your template? Have you, for example, cut it with restriction enzymes and checked the length of fragments?

> On Mar 14, 2016, at 11:09 AM, David Ishee <midgard...@gmail.com> wrote:
>
> No product on either one, but also no unexpected product.
>
> It was probably my template, I was in a hurry and didn't use a miniprep, I tried to use a bit of the plasmid bearing bacteria. I'll try again with a fresh miniprep tonight.
>

> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at https://groups.google.com/group/diybio.

> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/b8291393-a692-4ff0-835d-23886d59d4ec%40googlegroups.com.

[David Ishee]

I'm going to try again with better template tonight and another parallel run with some DMSO added. If they don't work I'll do a digest tomorrow night and see what I get. I may also run a 16s PCR too just to check.

If the digest doesn't work right I'll get primers for another large amplicon from a different plasmid that's had fewer generations since it was made and better sequence data (pDusk probably) and run that to see if the trouble is drift in the target sequence.

[Tom Knight]

DMSO percentages for PCR are usually in the 3-10% range of final volumes. Another very good (better, I think) PCR additive is betaine solution, again at 4-8%.

> On Mar 14, 2016, at 5:39 PM, David Ishee <midgard...@gmail.com> wrote:
>
> I'm going to try again with better template tonight and another parallel run with some DMSO added. If they don't work I'll do a digest tomorrow night and see what I get. I may also run a 16s PCR too just to check.
>
> If the digest doesn't work right I'll get primers for another large amplicon from a different plasmid that's had fewer generations since it was made and better sequence data (pDusk probably) and run that to see if the trouble is drift in the target sequence.
>

> --
> -- You received this message because you are subscribed to the Google Groups DIYbio group. To post to this group, send email to diy...@googlegroups.com. To unsubscribe from this group, send email to diybio+un...@googlegroups.com. For more options, visit this group at https://groups.google.com/d/forum/diybio?hl=en
> Learn more at www.diybio.org
> ---
> You received this message because you are subscribed to the Google Groups "DIYbio" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to diybio+un...@googlegroups.com.
> To post to this group, send email to diy...@googlegroups.com.
> Visit this group at https://groups.google.com/group/diybio.

> To view this discussion on the web visit https://groups.google.com/d/msgid/diybio/a0aee28d-d026-45d4-9521-1c5687495c6c%40googlegroups.com.

[David Ishee]

Thanks, I'll make sure I stay in that range

[Scott]

David,

If you are going to get another pair of primers to test then I would suggest you use the two outer Lux primers you already have and design two sense and antisense primers that amplify two overlapping halves of your target. Smaller targets are easier to amplify. You can then either combine the fragments through cloning of even another round of hifi PCR with the outer primers. Just an idea.

Cheers,

Scott

[David Ishee]

Good thinking it would be almost half the size and might give me my target in the end. But they would still be over 3000 Kb. Might save in the end or at least tell me if one of the primers isn't annealing.

[David Ishee]

16s worked and my plasmid looked good on the gel. Estimating from the ladder my template was around .06 nanograms in the PCR reaction. But Phusion, Phusion + DMSO, Q5, and Q5 + DMSO all failed to amplify.

A friend is sending me some primers that he's used successfully on pVIB before, I'll try it out and see how it goes. He doesn't remember exactly what they amplify but maybe I can figure it out and use them to figure out what's going on with my reaction.

[David Ishee]

Okay, I got a new plasmid in with m13 primer locations and a 7400 bp insert between them. So I'm going to try that for a long amplicon and see if I can make that.