in silico PCR problem

[Philip Stuart]

Hello,

 

The in silico PCR tool fails to find a match in the human hg19 reference for the following primers:

 

Forward:  TGGGTTCAAGCGATTCTCCT

Reverse:  AAAAGGAATGAAGGCTGGGC

 

The predicted 225 bp amplimer (chr7:1629577-1629801) for these primers returns a perfect full length match with the Blat tool, so there is a definitely a perfect match that the PCR tool is missing.

 

Thanks for your help.

 

Regards,

 

Phil Stuart

[Jonathan Casper]

Hello Phil,

Thank you for your question about obtaining PCR search results.

The PCR search tool is not returning results for your primers because they fall into a repetitive region of the genome. Our PCR tool uses the results of a BLAT search on the supplied primers to generate its output, but BLAT has difficulty placing short sequences in repeats. A BLAT search for your forward primer fails completely, while searching for the reverse primer yields several perfect matches. You can see which regions of the genome have been marked repetitive by turning on the RepeatMasker track under the "Variation and Repeats" heading of our main browser page at http://genome.ucsc.edu/cgi-bin/hgTracks. RepeatMasker is set to "dense" by default, but setting display to "full" will allow you to see individual repeated regions.

Your reverse primer appears to fare better due to being placed on the border between two different repeating elements. While it is better to avoid repeat regions when designing primers, you may have more luck centering your forward primer around the 1,629,470 or 1,629,122 positions of chr7. Those positions also fall on the border of two repeating regions, so a primer that includes both sides may be less susceptible to exclusion by BLAT.

For more information, you may also wish to consult the answer to this mailing list question: https://groups.google.com/a/soe.ucsc.edu/d/topic/genome/RI4YYAc8n1g/discussion.

I hope this is helpful. If you have any further questions, please reply to gen...@soe.ucsc.edu.

--
Jonathan Casper
UCSC Genome Bioinformatics Group

--