In Silico PCR no match

[Kim, Jake (NIH/NIMH) [F]]

Hello,

I used the UCSC In-Silico PCR to locate the following PCR primers:
Forward primer: GGATGTCCCCAAGCATCATT
Reverse primer: TTTGAGACCAGCCTGACCAA

However, it says "No matches to GGATGTCCCCAAGCATCATT TTTGAGACCAGCCTGACCAA in Human Feb. 2009 (GRCh37/hg19)."

I went back to BLAT Search Genome and it finds the forward primer but not the reverse primer. I double checked the reverse primer and it is complementary

[Brian Lee]

Dear Jake,

Thank you for using the UCSC Genome Browser and your question about In-Silico PCR, and the helpful details you provided to assist in a response.

A UCSC browser engineer examined the section and discovered that the reverse primer falls into an area of repeats, here is a link to a session displaying the primers and the RepeatMasker track: http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=brianlee&hgS_otherUserSessionName=Primers%20Blat%20Search

An engineer explained that at 20 bases, your sequences are near the limit of BLAT's sensitivity. With such short sequences, if BLAT has an over-used tile, a section of the query used to match and trigger an alignment, the algorithm will not be able to seed and extend an original BLAT hit in an area of repeats, which is likely happening with your reverse primer sequence.

You can see in the above session that a larger BLAT query will result in a hit. Since primers are typically chosen from unique locations, our engineer suggests it might be best to avoid a repeat-region, and notes that the nearby chr13:50,593,214-50,593,267 section appears to not have any repeats.

Thank you again for your inquiry and using the UCSC Genome Browser. If you have further questions, please feel free to contact the mailing list again at gen...@soe.ucsc.edu.

All the best,

Brian Lee

UCSC Genome Bioinformatics Group

--