Problems with InSilicoPCR

[Barbara Mesquita]

Good morning,

I had some problems using In Silico PCR and I hope to get some answers from you guys as I can't identify the problem here. Please find enclosed a word file explaining the issue.

Thank you so much!

--

Bárbara Sofia Maia Mesquita
Expression Regulation in Cancer, Research Fellowship

Instituto de Investigação e Inovação em Saúde, Universidade do Porto
Rua Alfredo Allen, 208 | 4200-135 Porto, Portugal

[Christopher Lee]

Hi Bárbara,

Thank you for your question about In-Silico PCR. In-Silico PCR
functions similarly to BLAT, and masks out repetitive sequence to make
finding matches easier. In your case, your reverse primer is
overlapping a SINE element:
http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=chmalee&hgS_otherUserSessionName=hg38_CDH1_intronSINE

and so you need to add enough extra sequence onto either end of your
reverse primer in order to get enough unique matches for In-Silico PCR
to report a result. In addition to extending the 5' end of your primer
in order to get a hit like you have done, you can also increase the 3'
end, I found the following reverse primer that works:
AGGCTGGTCTCAAACTCCTGGGCTCAAGTAATCCTG

The session link I sent above displays the results of In-Silico PCR
with this reverse primer, as well as the blat results of your yellow
highlighted sequence + sequence up to reverse primer.

Please let us know if you have any further questions!

Christopher Lee
UCSC Genomics Institute

Want to share the Browser with colleagues?
Host a workshop: http://bit.ly/ucscTraining

Thank you again for your inquiry and using the UCSC Genome Browser. If
you have any further questions, please reply to gen...@soe.ucsc.edu.
All messages sent to that address are archived on a
publicly-accessible forum. If your question includes sensitive data,
you may send it instead to genom...@soe.ucsc.edu.

> --
>
> ---
> You received this message because you are subscribed to the Google Groups
> "UCSC Genome Browser Public Support" group.
> To unsubscribe from this group and stop receiving emails from it, send an
> email to genome+un...@soe.ucsc.edu.
> To post to this group, send email to gen...@soe.ucsc.edu.
> Visit this group at https://groups.google.com/a/soe.ucsc.edu/group/genome/.
> To view this discussion on the web visit
> https://groups.google.com/a/soe.ucsc.edu/d/msgid/genome/1928615098.18145513.1513193684139.JavaMail.zimbra%40ipatimup.pt.
> For more options, visit https://groups.google.com/a/soe.ucsc.edu/d/optout.