Abiogenesis: Inorganic origins of the Krebs Cycle
John Vreeland
By Phil Berardelli
ScienceNOW Daily News
8 December 2006
How in the world did life emerge on a planet composed only of simple
chemical compounds? Scientists say they may have found part of the
answer in a mineral that seems to act as an effective catalyst for the
earliest organic processes.
Every organism on Earth, from the smallest bacterium to the blue whale,
makes energy using the same biochemical pathway. Called the Krebs--or
citric acid--cycle, this series of chemical steps converts
carbohydrates, fats, and proteins into energy that powers cellular
activities. To figure out how the Krebs cycle got started, scientists
have been working backward to identify the nonorganic materials that
originally helped set the cycle in motion.
Reporting in next week's Journal of the American Chemical Society,
researchers at Harvard University say they may have found at least one
of the original players. Called sphalerite, the compound is a mix of
zinc and sulfur ejected from hydrothermal vents and known to have been
plentiful in Earth's early seas. Geochemist and co-author Scot Martin
says the team's new lab experiments show that when immersed in sterile
water and exposed to sunlight, sphalerite can create three of the five
basic organic chemicals necessary to start the Krebs cycle in
relatively quick fashion. Further research is needed to isolate the
other compound or compounds that could have produced the remaining two
Krebs ingredients, he notes. If scientists can find their sources, then
they will know that the five chemical foundations of the Krebs cycle
were being manufactured easily and routinely in Earth's early oceans.
It's "elegant" research, says mineralogist Robert Hazen of the Carnegie
Institution in Washington, D.C. The idea that sphalerite can catalyze
three of the five Krebs cycle basic compounds all by itself is "an
exciting result ... [that brings us] a lot closer to understanding the
chemical origins of life."
derdag
Gen 1:20 ś And God said, Let the waters bring forth abundantly the
moving creature that hath life, and fowl [that] may fly above the earth
in the open firmament of heaven.
Grandbank
derdag wrote:
>
> Gen 1:20 ś And God said, Let the waters bring forth abundantly the
> moving creature that hath life, and fowl [that] may fly above the earth
> in the open firmament of heaven.
This just in:
"The truth, of course, is that the Raven found our forefathers in a
clamshell on the beach at Naikun. At his bidding, they entered a world
peopled by birds, beasts, and creatures of great power....."
- Bill Reed
Illustrated at:
http://www.wideangle.ca/archives/2004/10/the_raven_and_t.html
KP
bullpup
"derdag" <der...@chilledwatertech.com> wrote in message
news:1165623896....@j72g2000cwa.googlegroups.com...
Thanks for pointing out how Genesis does not match reality.
Boikat
>
>
derdag
Do you believe that ocean water is sterile water and that sunlight
reaches the floor of the ocean, or that the five organic compounds were
enzymes and that they also got trapped inside lipid membranes one day
with pores and DNA that coded for them as well? Maybe so, but I do
not.
Perplexed in Peoria
"John Vreeland" <vree...@yahoo.com> wrote in message news:1165620737....@80g2000cwy.googlegroups.com...
Here is an abstract:
http://pubs.acs.org/cgi-bin/abstract.cgi/jacsat/asap/abs/ja066103k.html
It appears that Berardelli badly garbles the story. Sphalerite doesn't
"catalyze three of the five Krebs cycle basic compounds all by itself".
It catalyzes three of the reductive steps in the pathway. There are more
than five compounds involved in the cycle.
The interesting reaction is the one from oxoglutarate (2KG) to oxalosuccinate.
That one is one of the key reactions adding carbon to the skeleton. I'm
curious whether this reaction (and the one from oxaloacetate to malate)
exhibit chiral specificity. Seems doubtful, since the mineral itself is
not chiral. Also interesting is that natural sphalerite almost always has
ferrous iron as a variable substituent for the zinc. Tiny microcrystals
of iron sulfide in the same cubic arrangement as in sphalerite play a big
part in almost all microbial redox reactions.
Rich Townsend
I'm a bit confused here. I thought the Krebs cycle was all about aerobic
respiration -- combining oxygen and carbohydrates to produce ATP and CO2. But
weren't the first prokaryotes anaerobic, relying on sulphur-based respiration?
Because free oxygen wasn't around at the start of it all?
cheers,
Rich
bullpup
Why don't you read up on the early conditions of the pre-biotic earth,
idiot. Hint" Titan, but a bit warmer.
> Maybe so, but I do
> not.
Do you believe that complete organisms just popped into existance out of the
water?
Boikat
Denis Loubet
> Do you believe that ocean water is sterile water
Well, sterile sort of suggests the absence of life, which is what you'd
expect before life arose.
Duh.
--
Denis Loubet
dlo...@io.com
http://www.io.com/~dloubet
http://www.ashenempires.com
Mujin
der...@chilledwatertech.com says...
> > > moving creature that hath life, and fowl [that] may fly above the earth
> > > in the open firmament of heaven.
> >
> > Thanks for pointing out how Genesis does not match reality.
> >
> > Boikat
> > >
> > >
>
> Do you believe that ocean water is sterile water
In the prebiotic world? Yes.
> and that sunlight
> reaches the floor of the ocean,
Is the ocean all one depth? I have this vague memory of shallow
bits where the land meets it...
> or that the five organic compounds were
> enzymes and that they also got trapped inside lipid membranes one day
> with pores and DNA that coded for them as well?
You really *don't* get this stepwise development thing, do you?
Perplexed in Peoria
"Rich Townsend" <rh...@barVOIDtol.udel.edu> wrote in message news:eldbvi$4rq$1...@scrotar.nss.udel.edu...
You are correct. But there is something called the "reversed citric acid
cycle" or the "reductive tri-carboxylic acid cycle" or the "Kandler cycle",
or permutations thereof, which is used in some micro-organisms to fix
carbon. Most of the intermediates are the same, and many of the near-equilibrium
reactions use the same enzymes. But a few of the steps are very different.
Specifically the steps which (in the oxidative direction) release CO2, capture
phosphate bond energy, and involve oxidations by NAD. In the reductive direction,
these steps now use completely different enzymes, ADD CO2, consume phosphate
bonds, and involve reductions by ferridoxin.
Back around 1990, an abiogenesis theorist named Gunter Wachtershauser suggested
that this cycle might possibly run without enzymes and without costing any
phosphate bonds on a catalytic surface of iron pyrite deep in subterranean
vents. He was probably wrong - the thermodynamics just doesn't quite work.
But more recently some people have speculated that it might work if the
reaction is moved up to shallow water and provided with an energy boost from
light or uv. This research is one more piece of that jigsaw puzzle.
One of the exciting aspects of this idea is that the reverse cycle is
'autocatalytic' for the cycle constituents. For example, starting from
oxaloacetate, proceed around the cycle adding CO2 and reducing and you
end up with two molecules of oxaloacetate. Sounds almost biological,
doesn't it?
Nashton
How can you post this with a straight face, knowing that the mechanism
of the first step, in a series of many, remains a deep mystery?
--
Nicolas
Marc
Nashton wrote:
> How can you post this with a straight face, knowing that the mechanism
> of the first step, in a series of many, remains a deep mystery?
Oh, I don't know. You seem to have posted the above question
without too much thinking or anything.
It's those pesky little "atom" things.... comes from a Greek
work but you wouldn't be able to relate to that, would you?
(signed) marc
..
Nashton
Now if only we can solve the mystery of how glucose was readily
available in order to be catabolised in the first place. Unless
scientists believe that pyruvate existed in nature without its
precursor, glucose.
Dunno about you, but I consider the manufacture of glucose vastly more
important than its breakdown. Moreover, when we fully figure out the
mechanism by which light actually splits water in PS, I'll be impressed.
In the meantime, grasping for straws is all we're going to get from the
scientists that are hell-bent on attempting to prove that abiogenesis
actually occurred.
--
Nicola
Marc
Nashton wrote:
> In the meantime, grasping for straws is all we're going to get from the
> scientists that are hell-bent on attempting to prove that abiogenesis
> actually occurred.
And when that has been shown, you will then accept evolution, right?
(signed) marc
Ye Old One
What has that fairy story got to do with it?
--
Bob.
er...@swva.net
I don't think they are trying to prove that it occurred; we already
know that life came about from non-life at some point because there is
no basis for thinking that it always existed. What scientists are
doing is trying to figure out _how_ it could have come about.
> --
>
> Nicola
Eric Root
er...@swva.net
>
(snip)
>
> Gen 1:20 ś And God said, Let the waters bring forth abundantly the
> moving creature that hath life, and fowl [that] may fly above the earth
> in the open firmament of heaven.
Cute. Now how did that supposedly work, in terms of actual forces and
molecules?
Eric Root
er...@swva.net
>
(snip)
>
> Gen 1:20 ś And God said, Let the waters bring forth abundantly the
> moving creature that hath life, and fowl [that] may fly above the earth
> in the open firmament of heaven.
Come back when you can explain a step-by-step method.
Eric Root
Nashton
> Nashton wrote:
>
>> How can you post this with a straight face, knowing that the mechanism
>> of the first step, in a series of many, remains a deep mystery?
>
>
> Oh, I don't know.
A+ for stating the obvious.
You seem to have posted the above question
> without too much thinking or anything.
That's it? that's your rebuttal?
>
> It's those pesky little "atom" things.... comes from a Greek
> work
Work?
but you wouldn't be able to relate to that, would you?
You'd be surprised.
Care to address any points I brought up or are you going to take another
shot at trying to be funny?
--
Nicolas
>
> (signed) marc
>
> ..
>
CreateThis
Funny that 90 percent of the population is religious and creation is
"intuitively obvious", yet nobody is even working on proving creation
occurred. When you're so busy trying to get "creation science" into
schools it must be hard to find time to actually do any.
Moron.
CT
Perplexed in Peoria
"Nashton" <nan...@nb.ca> wrote in message news:CBxeh.30372$cz.4...@ursa-nb00s0.nbnet.nb.ca...
Agreed, IF they were talking about running the Krebs cycle in the forward
direction. But, as I sketched in my reply to Townsend, these researchers
are looking at the reversed cycle. It doesn't consume carbon skeletons, it
produces them.
> Unless
> scientists believe that pyruvate existed in nature without its
> precursor, glucose.
Well, actually, pyruvate and alanine are produced in pretty good yields
by Miller-Urey experiments. Much better yields than glucose. So I
suppose it would not be *totally* crazy to be looking at the Krebs
cycle in the forward direction. But too crazy for me.
> Dunno about you, but I consider the manufacture of glucose vastly more
> important than its breakdown.
I fully agree, in the context of abiogenesis.
> Moreover, when we fully figure out the
> mechanism by which light actually splits water in PS, I'll be impressed.
Uh, apparently you are at least twenty years behind on your reading in
molecular biology and biochemistry. Photosystem 1 and photosystem 2 and
all that. Light isn't actually directly involved in the 'water-splitting',
though it does 'pay the bills for the process' in some sense.
> In the meantime, grasping for straws is all we're going to get from the
> scientists that are hell-bent on attempting to prove that abiogenesis
> actually occurred.
Oh, you are welcome to remain skeptical. But I would word it differently.
The people involved are not trying to prove something. They are trying
to figure out the how-it-happened. Not prove that-it-happened.
derdag
> > > > moving creature that hath life, and fowl [that] may fly above the earth
> > > > in the open firmament of heaven.
> > >
> > > Thanks for pointing out how Genesis does not match reality.
> > >
> > > Boikat
> > > >
> > > >
> >
> > Do you believe that ocean water is sterile water
>
> In the prebiotic world? Yes.
>
> > and that sunlight
> > reaches the floor of the ocean,
>
> Is the ocean all one depth? I have this vague memory of shallow
> bits where the land meets it...
>
> > or that the five organic compounds were
> > enzymes and that they also got trapped inside lipid membranes one day
> > with pores and DNA that coded for them as well?
>
> You really *don't* get this stepwise development thing, do you?
>
> > Maybe so, but I do
> > not.
> >
> >
> >
Hey! You are one of the posters who I will always read. You write it
well.
To answer: Maybe I do get it. Was it a virus? Did it have a boundry
between itself and outside of itself? Was the inside stuff actively
seeking materials outside of itself for metabolic process, which would
also be a necessity of genetic duplication? Would all of this membrane
structure, pores, Krebs enzymes, etc also types of RNA also be coded by
the genetic material driving it? Would part of it work without the
other parts? Which parts can be eliminated from this initial cells
genetic material (hypothetically) and allow it live or live and allow
for the time to adapt more genetic modification which included the
portion that I just hypothetically eliminated?
No. I don't.
derdag
I will when you can explain a step-by-step method that gets your side a
cell from a tidepool.
derdag
But, a requirement of the ToE would be to assume a first cell from
abiogenesis and allow code changes that result in one cell to adopt a
complete change from one metabolic system to another, which is almost
as irreducable as abiogenesis is in the first place.
I'm so happy that we're discussing the ToE at the first cell level and
IR problems which exist here. I'll cut to the chase. If the ToE is
having to be assumption right here at the first system changes in
single cells, on a theoretical level, that same problem exists with the
ToE all the way out to Desertphile's intestinal tract.
Free Lunch
"derdag" <der...@chilledwatertech.com> wrote in
<1165689395.6...@f1g2000cwa.googlegroups.com>:
That is silly argument. There is evidence about the history of life on
earth. There is no evidence for a creator.
Nashton
I think they are trying to prove that it occurred in a random fashion.
HTH
we already
> know that life came about from non-life at some point because there is
> no basis for thinking that it always existed. What scientists are
> doing is trying to figure out _how_ it could have come about.
Says who? Maybe life and matter have existed since the Universe began?
Maybe God created life as per Genesis. Can you prove otherwise?
Short answer: No.
--
Nicolas
>
>> --
>>
>> Nicola
>
> Eric Root
>
derdag
I believe that the science data supports that kind of mechanism, just
as accurately as anyone else who says that the data supports
abiogenesis caused by a random miracle.
>
> Boikat
I believe that the science data supports
Free Lunch
"derdag" <der...@chilledwatertech.com> wrote in
<1165692417....@n67g2000cwd.googlegroups.com>:
>
>bullpup wrote:
>> "derdag" <der...@chilledwatertech.com> wrote in message
>> news:1165634433.6...@l12g2000cwl.googlegroups.com...
...
>> > Do you believe that ocean water is sterile water and that sunlight
>> > reaches the floor of the ocean, or that the five organic compounds were
>> > enzymes and that they also got trapped inside lipid membranes one day
>> > with pores and DNA that coded for them as well?
>>
>> Why don't you read up on the early conditions of the pre-biotic earth,
>> idiot. Hint" Titan, but a bit warmer.
>>
>>
>> > Maybe so, but I do
>> > not.
>>
>> Do you believe that complete organisms just popped into existance out of the
>> water?
>
>I believe that the science data supports that kind of mechanism, just
>as accurately as anyone else who says that the data supports
>abiogenesis caused by a random miracle.
It is clear that you are ignorant of science. Why don't you stop telling
people things that aren't true and learn things that are.
>> Boikat
>
>I believe that the science data supports
nothing that you do.
Free Lunch
Nashton <nan...@nb.ca> wrote in
<E3Eeh.30606$cz.4...@ursa-nb00s0.nbnet.nb.ca>:
Random? Not in the sense that you use it.
>HTH
>
> we already
>> know that life came about from non-life at some point because there is
>> no basis for thinking that it always existed. What scientists are
>> doing is trying to figure out _how_ it could have come about.
>
>Says who? Maybe life and matter have existed since the Universe began?
>Maybe God created life as per Genesis. Can you prove otherwise?
>
>
>Short answer: No.
So what? It isn't the duty of people to prove that your fantasies aren't
true. It is up to you to provide some evidence that your claims have
something to do with reality. Right now, your claims are no more valid
than the Invisible Pink Unicorn, Thor, the Silver Surfer or the Flying
Spaghetti Monster.
Mujin
der...@chilledwatertech.com says...
> > > > > moving creature that hath life, and fowl [that] may fly above the earth
> > > > > in the open firmament of heaven.
> > > >
> > > > Thanks for pointing out how Genesis does not match reality.
> > > >
> > > > Boikat
> > > > >
> > > > >
> > >
> > > Do you believe that ocean water is sterile water
> >
> > In the prebiotic world? Yes.
> >
> > > and that sunlight
> > > reaches the floor of the ocean,
> >
> > Is the ocean all one depth? I have this vague memory of shallow
> > bits where the land meets it...
> >
> > > or that the five organic compounds were
> > > enzymes and that they also got trapped inside lipid membranes one day
> > > with pores and DNA that coded for them as well?
> >
> > You really *don't* get this stepwise development thing, do you?
> >
> > > Maybe so, but I do
> > > not.
> > >
> > >
> > >
>
> Hey! You are one of the posters who I will always read. You write it
> well.
>
> To answer: Maybe I do get it.
> Was it a virus?
Was what a virus? The first living thing? If this is what you
mean, then I sincerely doubt it. What I have read regarding
abiotically occurring analogs to biological processes suggests that
viruses represent the extreme of a system which has over time
developed many jury-rigged parts as it slowly "drifts" toward some
level of fitness, and then having achieved that level of fitness
irrelevant parts proceeds to lose irrelevant side-trails and
now-unnecessary intermediates until it has "downsized" to the
minimum necessary to do the job. This seems to be a classic case of
scaffolding and subsequent loss of excess coming to appear to be
irreducably complex.
> Did it have a boundry
> between itself and outside of itself?
First life? I think on the whole it might depend largely on how one
defines "life" - which is somewhat disputable. In fact, my position
is that there is no strict boundary between life and non-life, that
the duality of these two conditions is merely a useful
classification which breaks down at certain scales.
In any case, going back to your question and its possible meaning
when aimed squarely at the window of transition between unambiguous
non-life and unambiguous life:
No, I don't think there was initially any boundary for many possible
self-sustaining chemical cycles. In fact, the sphalerite study
indicates that no boundary is necessary for at least some portions
of the Krebs cycle as we know it. Notice how sphalerite appears to
be able to perform the catalytic functions of various enzymes in the
modern cell. It's important to see that abiotic processes can
produce a particular result seen in biotic processes because it
shows that the biotic enzymes are *not necessary* - they are merely
ideal catalysts, while adequate catalysts like sphelerite can do the
job just fine. Interestingly, there is older research which shows
that iron sulfide also catalyses the production of necessary
compounds from readily available simple gasses (pyruvic acid from
CO):
George D Cody et al (2000) "Primordial Carbonylated Iron-Sulfur
Compounds and the Synthesis of Pyruvate " Science 25 August 2000:
Vol. 289. no. 5483, pp. 1337 - 1340
(E-version here:
http://www.sciencemag.org/cgi/content/abstract/289/5483/1337
you might need registration or subscription if you're not accessing
through an academic library)
Abstract:
Experiments exploring the potential catalytic role of iron sulfide
at 250°C and elevated pressures (50, 100, and 200 megapascals)
revealed a facile, pressure-enhanced synthesis of organometallic
phases formed through the reaction of alkyl thiols and carbon
monoxide with iron sulfide. A suite of organometallic compounds were
characterized with ultraviolet-visible and Raman spectroscopy. The
natural synthesis of such compounds is anticipated in present-day
and ancient environments wherever reduced hydrothermal fluids pass
through iron sulfide-containing crust. Here, pyruvic acid was
synthesized in the presence of such organometallic phases. These
compounds could have provided the prebiotic Earth with critical
biochemical functionality.
Both sphalerite and iron sulphide are interesting, because they are
produced in quantity by geothermal vents. Hydrothermal conditions
likewise stimulate the crystallization of orthophosphates:
http://www.springerlink.com/content/u5514r79w326qp38/
And as we already know from the Miller-Urey experiments and from
John Oro's subsequent exploration of the subject, a number of fairly
important organic molecules including ribose and nucleic acids are
produced under conditions that seem probable for the early Earth.
None of these reactions need isolation, and could occur naturally in
hotsprings or near undersea geothermal vents.
Remember - there is nothing privileged about biotic chemistry. The
only difference between biotic chemistry and abiotic chemistry is
that the former occurs in things we always classify as alive. The
same atoms are involved, and the same electronic interactions will
produce the same results.
> Was the inside stuff actively
> seeking materials outside of itself for metabolic process, which would
> also be a necessity of genetic duplication?
You're presuming that the earliest self-replicating systems required
genetic duplication - in fact we know that in nature there are many
chemical systems which reproduce themselves simply because that is
in the nature of the chemistry involved.
> Would all of this membrane
> structure, pores, Krebs enzymes, etc also types of RNA also be coded by
> the genetic material driving it? Would part of it work without the
> other parts?
Well, yes - this is exactly what research into possible geogenesis
models sets out to find out, and in an increasing number of cases it
is exactly what is discovered. The upcoming article on sphelerite's
action as a catalyst for the production of several elements of the
citric acid cycle shows quite clearly that the "parts" which seem
necessary in the cell can actually be replaced by very simple
inorganic analogs.
> Which parts can be eliminated from this initial cells
> genetic material (hypothetically) and allow it live or live and allow
> for the time to adapt more genetic modification which included the
> portion that I just hypothetically eliminated?
>
> No. I don't.
Think of it this way:
Imagine a tiny company which is started to fill a previously
unexplored market.
Initially, in order to make its product it has to make do with the
materials already available from suppliers, but eventually it may be
large enough to request specially-made parts or to engineer the
parts itself.
As it grows larger and larger, many variants of the initial product
will be released in order to take advantage of a multitude of frings
markets, and the company will get more and more complex as it gets
larger and larger.
Ultimately, though, it will either be faced by competition for
market share or access to components as other companies see that the
idea works, or if no competition arises it will reach a point where
further expansion will cost more than the potential gain.
Given that the marketplace and relative health of suppliers is not
constant, it doesn't matter how the system reaches this critical
point because however it happens the company will eventually find
itself under pressure to increase efficiency so as to maximize the
value of the market share it has managed to hold on to.
In order to increase efficiency, it may well decide to streamline
elements of production, and it might well end up reassessing the
merits of different dimensions of the marketplace and choose to
focus on a selection of sub-markets rather than spreading resources
thinly over the entire spectrum.
Ultimately, this reduced, robust company may bear little resemblance
to the original. Consider the history of nintendo as an example:
http://www.nintendo.com/corp/history.jsp
*This* is how scaffolding and reduction can produce seemingly
irreducably complex systems. It really is more like building an
arch out of toy blocks than it is like building a wall or tower.
If the scaffolding is removed, it often *does* appear that no
stepwise method could produce the object, but this is only because
we normally only visualize things in terms of placing one block on
top of another until the structure is finished. In reality, though,
many different kinds of steps might be necessary - some of which
would increase the "complexity" of the structure temporarily. You
can visualize it as a graph, where the vertical axis indicates the
degree of complexity (how many parts are needed to make the system
work) while the horizontal axis indicates the % completion toward
the final product. In the case of an arch, just as in the
hypothesized case for early biotic systems, one can imagine the
curve rising slowly until it is far to the right of center, and then
falling again to a stable equilibrium. If all you see is the
equilibrium, it may be difficult to see how it was reached - but
that doesn't mean it was impossible.
As an illustration of seemingly impossible things which are
nevertheless achieved through a number of later discarded steps, I
invite you to take a look at Ian Rowland's "Wow cards":
http://www.ianrowland.com/WowCards/WowCardsReFlexGallery1.html
Lee Oswald Ving
news:1165692417....@n67g2000cwd.googlegroups.com:
> I believe that the science data supports that kind of mechanism, just
> as accurately as anyone else who says that the data supports
> abiogenesis caused by a random miracle.
Nice. "Answering" a question by building a Straw Man to use as a Red
Herring.
What problem do you have with honest, straightforward answers, buddy?
Lee Oswald Ving
news:1165690417.0...@16g2000cwy.googlegroups.com:
> But, a requirement of the ToE would be to assume a first cell from
> abiogenesis
Not a requirement of ToE.
Problem solved - you can stop harping about it.
<snip>
bullpup
>
> bullpup wrote:
> > "derdag" <der...@chilledwatertech.com> wrote in message
> > news:1165634433.6...@l12g2000cwl.googlegroups.com...
> > >
<snip>
> > > Do you believe that ocean water is sterile water and that sunlight
> > > reaches the floor of the ocean, or that the five organic compounds
were
> > > enzymes and that they also got trapped inside lipid membranes one day
> > > with pores and DNA that coded for them as well?
> >
> > Why don't you read up on the early conditions of the pre-biotic earth,
> > idiot. Hint" Titan, but a bit warmer.
> >
> >
> > > Maybe so, but I do
> > > not.
> >
> > Do you believe that complete organisms just popped into existance out of
the
> > water?
>
> I believe that the science data supports that kind of mechanism, just
> as accurately as anyone else who says that the data supports
> abiogenesis caused by a random miracle.
Is that a "yes"?
> >
>
> I believe that the science data supports
>
The evidence, in light of the temporal development of species, does not
support complete organisms popping into existance in the context of
abiogenesis. Neither do any other observations in nature.
Boikat
bullpup
"Lee Oswald Ving" <leeo...@yahoo.com> wrote in message
news:Xns989493BACF444...@208.49.80.188...
Honest and straight forward answers would expose his ignorance.
Boikat
>
bullpup
All that the ToE requires is the first self replicating "cell" of similar
self contained organism. It does not matter how it came into existance.
>
> I'm so happy that we're discussing the ToE at the first cell level
Then you no longer need ot concern yourself with abiogenesis.
> and
> IR problems which exist here. I'll cut to the chase. If the ToE is
> having to be assumption right here at the first system changes in
> single cells, on a theoretical level, that same problem exists with the
> ToE all the way out to Desertphile's intestinal tract.
Ireducible complexity? The argument from ignorance? That's your problem,
not a problem for the ToE.
Boikat
Wakboth
bullpup kirjoitti:
Now he gets to be both dishonest and ignorant.
-- Wakboth
Perplexed in Peoria
"derdag" <der...@chilledwatertech.com> wrote in message news:1165690417.0...@16g2000cwy.googlegroups.com...
> abiogenesis and allow code changes that result in one cell to adopt a
> complete change from one metabolic system to another, which is almost
> as irreducable as abiogenesis is in the first place.
It is not completely clear to me what you are saying here, but I'll
try to address it thusly:
Life, as it exists today, exhibits a great variety of 'metabolic systems'.
There are organisms that use CO2 as food and produce methane as waste.
There are organisms that use methane as food and produce CO2 as waste.
Organisms like you and I consume oxygen. Outside my window are a bunch
of organisms that produce oxygen. (Well, they will once the weather
gets warmer in a few months, anyways).
All of these organisms are presumably descended from a single common
ancestor which used a 'metabolic system' different from any that I have
mentioned here. Pretty much every organism alive today can point back
to an environmental crisis in the past in which its ancestors had to
invent a whole new metabolic system or be relegated to the margins of
the biosphere. They did so. It happened. Repeatedly.
Your skepticism is maybe warranted, because a 'metabolic system' has a
kind of 'irreducible complexity' in the sense of Behe. The Krebs cycle
is an IC system according to Behe's original definitions. But even
Behe admits that it is not a good example of an IC system which would
be nearly impossible to evolve under RM+NS. In fact, and Behe would
admit this, those pieces-parts (enzymes and reaction sequences) are
shared in a mix-and-match system among several different metabolic
systems. In fact, we can almost read out their history just by noticing
which systems share components. I already mentioned the fact that some
(not all!) of the same enzymes are used for both directions of the
Krebs cycle. Completely different 'metabolic systems', with completely
different logics and outcomes, but they both use some of the same
enzymes. It is evidence *for* evolution, not an argument against
evolution.
wf3h
Nashton wrote:
>
> Says who? Maybe life and matter have existed since the Universe began?
> Maybe God created life as per Genesis. Can you prove otherwise?
>
well, it's obvious nasht has never read the bible.
the bible says god created life. it does not say how.
but creationists are always willing to tell god what they think he
should know.
Free Lunch
They don't support his delusions.
Marc
Nashton wrote:
> Marc wrote:
> > Nashton wrote:
> Care to address any points I brought up or are you going to take another
> shot at trying to be funny?
Let's hear your answer to this question first -
If abiogenesis is shown to be highly feasible will you then
accept evolution as a means for explaining the resulting
array of life on Earth?
(signed) marc
er...@swva.net
You first; since a) creationists demanding step-by-step methods are
extremely old hat, lame, and brain-dead, and it's what I was spoofing.
Since you missed that, and in fact spouted that same age-old
creationist claptrap, you are doubly a loser, and b) you are the one
proposing something outside mainstream science, so you are the one who
has the burden of proof.
The only thing you could do to come off _triply_ a loser would be to
start babbling about atheists.
Eric Root
derdag
Mujin wrote:
> In article <1165688682.2...@n67g2000cwd.googlegroups.com>,
> der...@chilledwatertech.com says...
> >
> > Mujin wrote:
> > > In article <1165634433.6...@l12g2000cwl.googlegroups.com>,
> > > der...@chilledwatertech.com says...
> > > >
> > > > bullpup wrote:
> > > > > "derdag" <der...@chilledwatertech.com> wrote in message
> > > > > news:1165623896....@j72g2000cwa.googlegroups.com...
> > > > > >
> > > > > > John Vreeland wrote:
> > > > > > > Nature's Jump-Starter
> > > > > > >
> > > > > > > By Phil Berardelli
> > > > > > > ScienceNOW Daily News
> > > > > > > 8 December 2006
> > > > > > How in the world did life emerge on a planet composed only of simple
> > > > > > > chemical compounds? Scientists say they may have found part of the
> > > > > > > answer in a mineral that seems to act as an effective catalyst for the
> > > > > > > earliest organic processes.
> > > > > > >
> > > > > > > makes energy using the same biochemical pathway. Called the Krebs--or
> > > > > > > citric acid--cycle, this series of chemical steps converts
> > > > > > > carbohydrates, fats, and proteins into energy that powers cellular
> > > > > > > activities. To figure out how the Krebs cycle got started, scientists
> > > > > > > have been working backward to identify the nonorganic materials that
> > > > > > > originally helped set the cycle in motion.
> > > > > > >
> > > > > > > Reporting in next week's Journal of the American Chemical Society,
> > > > > > > researchers at Harvard University say they may have found at least one
> > > > > > > of the original players. Called sphalerite, the compound is a mix of
> > > > > > > zinc and sulfur ejected from hydrothermal vents and known to have been
> > > > > > > plentiful in Earth's early seas. Geochemist and co-author Scot Martin
> > > > > > > says the team's new lab experiments show that when immersed in sterile
> > > > > > > water and exposed to sunlight, sphalerite can create three of the five
> > > > > > > basic organic chemicals necessary to start the Krebs cycle in
> > > > > > > relatively quick fashion. Further research is needed to isolate the
> > > > > > > other compound or compounds that could have produced the remaining two
> > > > > > > Krebs ingredients, he notes. If scientists can find their sources, then
> > > > > > > they will know that the five chemical foundations of the Krebs cycle
> > > > > > > were being manufactured easily and routinely in Earth's early oceans.
> > > > > > >
> > > > > > > It's "elegant" research, says mineralogist Robert Hazen of the Carnegie
> > > > > > > Institution in Washington, D.C. The idea that sphalerite can catalyze
> > > > > > > three of the five Krebs cycle basic compounds all by itself is "an
> > > > > > > exciting result ... [that brings us] a lot closer to understanding the
> > > > > > > chemical origins of life."
> > > > > >
A cell is small. It occupies a fairly minute piece of territory. If I
go back and hunt through this list of (and it's also a partial list
where no portion of it gets me a cell or life) and I look up the
special conditions which were provided and used as given assumptions or
environment where each finding that you mentioned and show that they
are *different conditions*, I will want to make my own assumption that
these various natural processes don't seem as plausible as it sounds
written in the context of one cell sized volume in one location. And,
it will still be required to be coded for by either RNA or DNA to be
the beginning point of what we agree is life and what is meant by life
as per the ToE. So, I really do have issues on a scientific level with
the "plausibility" of it happening due to that process in light of all
that I have seen, even now.
derdag
And, it's congruent with ID.
Michael Siemon
"derdag" <der...@chilledwatertech.com> wrote:
Since ID deliberately says nothing at all, anything is congruent with ID.
Nashton
No, spoiled brat, you can't have it your way.
This isn't about the aforementioned, respond to my post first and then
create another thread to discuss my acceptance of ToE.
--
Nicolas
bullpup
Buck-buck-baKAW!!
Boikat
Marc
Just trying to give you a chance to explain yourself, but really...
like I give a big damn about your latest pathetic excuse for denial
in evolution. If you can't deny abigenesis then you won't be able
to deny evolution - not that denial of evolution means understanding
anything else in it's place in your case. Ever study any chemistry?
(signed) marc
.
Mujin
There are several issues here. You are still presuming that both
the bounded cell and the earliest "metabolizing" chemical systems
must have arisen simultaneously. However, as we can see from the
research that has been done so far, at least some of the necessary
processes can take place under natural (i.e. unbounded) conditions.
While we have not filled in all the gaps, it is plausible that the
bits we don't have a model for yet will also turn out to take place
under similar natural conditions.
If you look to the examples I gave above, you will find that while
they require different conditions, they are not mutually exclusive
conditions.
Iron sulphide is produced by geothermal vents, as is sphalerite.
Geothermal vents don't exclude the presence of sunlight (to drive
the sphalerite reaction) and don't require deep water.
Electrical activity and ionizing radiation in the early atmosphere
would produce tholins and the basic building blocks of the
Miller-Urey experiments, and as Oro showed many of these basic
building blocks can spontaneously (in the Gibbs sense) combine under
fairly normal-seeming conditions to produce things like ribose and
pyruvate.
The water cycle is well known to draw high-altitude material to the
surface, where it can combine with the sphalerite and iron sulphite
solutions.
None of these reactions actually require anhydrous conditions to
function, but for those which are sensitive to water the conditions
suggested predict quantities of hydrophobic tholins, some of which
are variously denser or less dense than water, and could be expected
to form films either on the surface or on the bed of bodies of
water, providing an environment in which they can be protected from
hydrolysis. How do things cross the barrier? Well, they may not
need to, if the early life-like systems used immiscibility rather
than actual encapsulation to protect water-sensitive materials:
there are any number of syntheses in organic chemistry in which
reagents dissolved in different immiscible liquids react with one
another *at the interface* between the two liquids.
*IF* we can show that the necessary components arise spontaneously
(and several of the components clearly do); and
*IF* we can show that what we understand to have been the natural
conditions of the early Earth makes it almost inevitable that these
materials would have been admixed from time to time; then
geogenesis is a plausible explanation.
Is some of what geogenesis proposes speculative? Absolutely. But
the point is that researchers who are interested in geogenesis have
made it their business to work out what kinds of conditions are
necessary, figure out if those conditions actually produce the
desired result, and then go out of their way to look for reasons why
those conditions should have been present on the early Earth. In
some cases, they're able to go a step further and find geological
evidence that such conditions *did* occur, right in the time period
necessary.
This is what makes it seem to be a plausible (but as yet
unconfirmed) explanation for the emergence of life.
So far, I have seen no compelling evidence to exclude natural agency
for *any* of the necessary elements of an early cell.
> And,
> it will still be required to be coded for by either RNA or DNA to be
> the beginning point of what we agree is life and what is meant by life
> as per the ToE.
OK, so let's presume for the sake of argument that all the basic
elements of the citric acid cycle have been confirmed to be
producable by natural processes which we know to have been present
on the early Earth, and all are known to have been present in the
same environments, such that the citric acid cycle could arise
spontaneously. The "energy" aspects of the cycle aren't
problematic under these circumstances since aqueous phosphate
ions are naturally occurring, and adenine and ribose are readily
produced in Miller-Urey/Oro apparatuses - the synthesis of adenosine
is straightforward given these two.
The earliest versions of this cycle would use mineral catalysts -
sphelerite and iron sulphide among them, and at least one other
AFAICT. But these catalysts are not very specific, and thus could
easily be replaced by a simple polypeptide which has the appropriate
electronic configuration. Let's assume for a moment that
appropriate polypeptides arise spontaneously in the environment in
which a mineral version of the citric acid cycle would arise, so
that we can move directly to the question of how an early genome
could arise.
You are assuming that the first genomes would have to look like
modern genomes, but it's not really necessary for them to look
modern at all.
First of all, it's not necessary for an early living system to use
RNA or DNA at all.
A series of simple autocatalytic cycles involving polypeptides could
add amino acids to a peptide chain:
Enzyme A "primes" an amino acid (1) by linking to it and altering
its electronic configuration.
Enzyme B "primes" a second amino acid (2), producing a complementary
electronic configuration.
EnzA-1 bonds with EnzB-2, and the resulting change in electronic
configuration releases EnzB and EnzB, leaving a simple peptide 1-2
EnzA now primes another AA (3) while EnzC primes the peptide 1-2
EnzA-3 + 1-2-EnzC -> EnzA-3-1-2-EnzC -> EnzA + EnzC + 3-1-2
We can presume that these reactions are powered by ADP or ATP
generated by the primitive citric acid cycle.
If the peptide 3-1-2 happens to be an active enzyme in this cycle or
a complementary cycle, it will probably cease building because
entering the cycle as an enzyme rather than a substrate usually has
a more entropic equilibrium. (I am assuming I remember my organic
chemistry, and will no doubt have my knuckles rapped by someone)
I can think of no particular reason, in such a simple environment,
that the *same* enzyme could not perform the functions of EnzA, EnzB
and EnzC, but even if this isn't possible in a specific case, a
series of complementary cycles can produce appropriate enzymes which
feed into each other.
Notice that this type of model works entirely with amino acids, no
RNA or DNA needed for self-replication provided energy is available
(via AD/TP, sunlight, free radicals, ambient radiation, red/ox, etc)
and the necessary components spontaneously occur from inorganic
precursors.
However, we can see that because of the nature of chemistry these
protoenzymatic cycles might have significantly less than 100%
accuracy; any time the product doesn't match what is needed closely
enough, the cycle fails to reproduce anything but more complex
tholins which accumulate as waste. (but might break down from
natural processes to serve as raw materials again) The more
specific the enzymes, the better - small peptides are not very
specific. RNA, on the other hand, can serve all manner of enzymatic
functions, and can be quite specific.
If it turns out to be possible for nucleotides to form under
prebiotic conditions (we know that adenine and ribose can form,
making adenosine possible) then short-chain RNA polymers should also
be able to form. Many possible polymers of the four universal bases
are not capable of complete spontaneous self-replication (only
portions replicate by base-pairing, resulting in fragments), but
some *do* and if any proportion of the naturally occurring polymers
of RNA have this property, they will tend to compete (in the
chemical sense) more aggressively for free bases and due to their
capacity for replication will soon dominate the environment.
Here's an old article on how they thought the chemistry of an RNA
world might work back in the late 90s:
http://www.msu.edu/user/wingerdb/rna.htm
Now, one objection to this model is the idea that something looking
like a modern gene would be difficult to arrive at by pure
coincidence, even allowing for the non-random processes involved in
chemistry. However, this objection is assuming that only a fully
modern gene - complete with a start sequence, discrete triplets
coding for amino acids in sequence, and a stop sequence - can do the
job. But this isn't actually the case.
First of all, *any* RNA polymer which reliably self-replicates by
base-pairing will work just fine, it just won't be a gene. Provided
it catalyses its own replication, and somehow participates in the
amino acid or base synthesis cycles (perhaps the strand functions as
a kind of tRNA, enzymatically priming an amino acid or polypeptide
in one of the cycles) I think we can say that it's serving at least
a proto-genome function. However, there are some possibilities for
gene encoding which don't require a modern-type structure.
Consider the following randomly generated 20 base RNA sequence
(ignoring the fact that spontaneously arising polymers don't
typically form in a truly random fashion):
ACGGUAUAUAACUUUCGAGU
How many coding triplets are there in this sequence?
ACG = Threonine
CGG = Arginine
GGU = Glycine
GUA = Valine
UAU = Tyrosine
AUA = Isoleucine
UAU = Tyrosine
AUA = Isoleucine
UAA = STOP
AAC = Asparagine
ACU = Threonine
CUU = Leucine
UUU = Phenylalanine
UUC = Phenylalanine
UCG = Serine
CGA = Arginine
GAG = Glutamic acid
AGU = Serine
Theoretically, then, this mere 20-base RNA can code for an 8aa
polypeptide and a 9aa polypeptide. If, like some viral RNAs, the
polymer is a loop, then it could code for a single 17aa polypeptide.
If any of the three possibilities are enzymatically active, is
capable of taking the place of mineral catalysts involved in the
system's growth, and is more specific than the mineral catalysts it
will ratchet up the system's rate of growth. And of course, there
is no requirement that the proto-genes all reside on a single strand
- a mixture of fragments, each bearing one viable sequence, would do
the job just as well - probably better since with such short
sequences activity at one locus would probably inhibit activity
elsewhere, limiting which sequence gets expressed by competition
between electronically active sites.
Now, not every "randomly" assembled RNA fragment will code for
something useful, but of course the ones which both self-replicate
and generate a polypeptide which can function as an enzyme in the
supporting cycle will eventually out-compete alternative reactions,
that being the nature of feedback loops in chemistry.
And this *still* assumes that triplets are necessary, not just
optimum. There might be many other possible ways of coding
polypeptides on RNA that we don't see in the natural world simply
because they are sufficiently inferior to the system currently used
by all life that they became "extinct".
Some of the reactions necessary in this kind of *extremely* complex
chemical system might require anhydrous conditions to proceed
properly, but as I noted earlier, many syntheses in organic
chemistry take place at the interface between immiscible liquids.
Hydrophobic tholine globules or films would serve as the substrate
for this sort of reaction.
This model of an early genome that interacts with early metabolic
pathways doesn't have all its parts isolated in a discrete unit -
but is this a necessary quality of a proto-lifeform?
(I'm going to ignore the idea that crystals could serve as genetic
templates for the moment, primarily because I'm not clear on just
how they would work.)
> So, I really do have issues on a scientific level with
> the "plausibility" of it happening due to that process in light of all
> that I have seen, even now.
I don't think you're using the right word here. The word you seem
to want is "pleasing."
Quite a few plausible explanations have been put forward. Some
aspects of some of the explanations have been confirmed by looking
for the sorts of things that would be necessary for them to work.
Are there still questions? Absolutely, and on the whole I think
that geogenesis theories are still very speculative - and may never
get any better. But since there *are* plausible naturalistic
explanations, and there exists the potential for the gaps in our
confirmation of these explanations to be filled in the future, it
seems a rather dicey place to hide the option for an intelligent
designer.
Though of course you're free to slip one in there.
derdag
I don't mind seeing a post which is very much more thorough than I
could produce, which is counter to my direction of fire. You have put
it up in very elegant and logical form. And, I like it and also
understand the parts which are assumed, hypothesised and given latitude
against high odds. The evolution crowd sure thinks that this stuff is
settled by the way they post. You don't use the terminology in the
same way that they do, and You may lean toward open mindedness for new
answers and less assumption in the future for abiogenesis. That is
fine by me, as I am just as open to any real science myself. It is
also true that anyone who thinks that it can be proven to have happened
that way is wrong. This can not be proven, anymore than an ID can be
proven. Until some evidence disproves that an ID had influence, or
until it is proven that these circumstances could not have happened
naturally, you will be open to and leaning toward that natural
scenario. Fine, while at work... We're discussing science. It's all
hinging on this, or possibly not. I am satisfied that anyone
postulating an ID can use the same scientific evidence and point to
plenty of things that appear to show or be in line with the actions of
a designer. In the context of hypothetical and postulated reasoning
based on known science to this date and to this depth of understanding,
are you willing to state that some evidence that you have seen is
contradictory to an ID creation? Or, is there some reason which
"folks" should come to 'believe' that the answers are in and contrary
to an ID? I personally don't see the value to having a great portion
of the scientific establishment act and write in a way which is
dishonest and tries to say that this disproves a first cause. You are
more honest than that, are you not?
Mujin
der...@chilledwatertech.com says...
>
> Mujin wrote:
> > In article <1165732032.2...@73g2000cwn.googlegroups.com>,
[snip]
> > Quite a few plausible explanations have been put forward. Some
> > aspects of some of the explanations have been confirmed by looking
> > for the sorts of things that would be necessary for them to work.
> >
> > Are there still questions? Absolutely, and on the whole I think
> > that geogenesis theories are still very speculative - and may never
> > get any better. But since there *are* plausible naturalistic
> > explanations, and there exists the potential for the gaps in our
> > confirmation of these explanations to be filled in the future, it
> > seems a rather dicey place to hide the option for an intelligent
> > designer.
> >
> > Though of course you're free to slip one in there.
>
> I don't mind seeing a post which is very much more thorough than I
> could produce, which is counter to my direction of fire. You have put
> it up in very elegant and logical form. And, I like it and also
> understand the parts which are assumed, hypothesised and given latitude
> against high odds. The evolution crowd sure thinks that this stuff is
> settled by the way they post. You don't use the terminology in the
> same way that they do, and You may lean toward open mindedness for new
> answers and less assumption in the future for abiogenesis.
I'm open to any answer which seems plausible and at least has the
potential to be supported by evidence. So far, geogenesis seems to
be the only "answer" in which people have suggested ways to test it,
and in fact have found some of the sorts of things which are
predicted by it.
> That is
> fine by me, as I am just as open to any real science myself. It is
> also true that anyone who thinks that it can be proven to have happened
> that way is wrong.
I think it would be a mistake to say that geogenesis can be proven
absolutely in the way that, say, the relationship between mass and
gravitation can be proven. I think it *can* be supported in various
ways, and so far has been in some cases.
> This can not be proven, anymore than an ID can be
> proven.
Actually, I can't see any way at all that ID can be proven absent
detection of the designer(s) in question. This doesn't
automatically render the possibility impossible, it just makes
exploration of possible natural explanations more fruitful. If
nothing else, the more we know about the natural explanations, the
more we would have to work with if we *did* eventually detect a
designer. But how would we go about detecting an ID? I've never
seen a proposed method that wouldn't produce ambiguous results.
> Until some evidence disproves that an ID had influence, or
> until it is proven that these circumstances could not have happened
> naturally, you will be open to and leaning toward that natural
> scenario. Fine, while at work... We're discussing science. It's all
> hinging on this, or possibly not.
? I don't get this.
> I am satisfied that anyone
> postulating an ID can use the same scientific evidence and point to
> plenty of things that appear to show or be in line with the actions of
> a designer. In the context of hypothetical and postulated reasoning
> based on known science to this date and to this depth of understanding,
> are you willing to state that some evidence that you have seen is
> contradictory to an ID creation?
No, because I don't know what unambiguous evidence in favour of an
ID creation would look like. Lots of things have been proposed, but
they all seem to have equally plausible possible natural
explanations as well.
John Vreeland
opined:
That's amusing. If it were true that science did support such a
conclusion, then the battle would be over. We could simply state that
"science clearly shows that the first organisms popped into existence
out of nothing."
But science doesn't show that, so we have to keep looking to figure
out how it happened.
--
My credentials? I have _excellent_ karma on Slashdot.
---John Vreeland (Vreejack)
John Vreeland
<mlsi...@sonic.net> opined:
I was going to take offense at that statement, but I just realized it
is true. You cannot disprove ID.
I had forgotten that. It is sort of funny.
ID is true in the same way that it might be true that Derdag is really
a very wise person who simply plays a perfect fool for his own
amusement.
hersheyhv
derdag wrote:
> Mujin wrote:
[snip]
No one in science claims that abiogenesis is "solved" or "proven". But
abiogenesis is not evolution. Biological type evolution involves
changes in self-replicating systems that have genetic programs
(mechanisms for transmitting information to future generations). Such
systems (and you may or may not consider all such systems as 'alive')
are a precondition for biological type evolution.
> You don't use the terminology in the
> same way that they do, and You may lean toward open mindedness for new
> answers and less assumption in the future for abiogenesis. That is
> fine by me, as I am just as open to any real science myself. It is
> also true that anyone who thinks that it can be proven to have happened
> that way is wrong.
Science isn't in the "proving" business. "Proof" implies that an
absolute truth exists that we can capture by making a set of
propositions that are untestable themselves and logically determining a
conclusion based on those assumed propostions. "Proof" is for
mathematicians. Science can only produce explanations that are better
and better approximations of how material reality works. Thus all its
explanations are tentative and must continuously be able to be testable
against evidence from material reality. Scientific explanations do not
have to be "right". They do have to be "usefully wrong" or "wrong by
reference to material reality". ID fails this test. It may be
"right". It may even be "true". But it cannot be "usefully wrong"
until it can be tested to determine if it is "wrong" about something.
> This can not be proven, anymore than an ID can be
> proven. Until some evidence disproves that an ID had influence, or
> until it is proven that these circumstances could not have happened
> naturally, you will be open to and leaning toward that natural
> scenario.
What sort of evidence *could* possibly *disprove* the idea that some
unspecified, unknowable wrt material reality, undetectable something
that is asserted to be intelligent did something by some unobservable
mechanism to somehow produce whatever exists at some unspecified time
and unspecified place? How can ID be "usefully wrong"? If ID cannot
be "usefully wrong", it is not science; it is religious belief.
In contrast, natural selection can be usefully wrong. Evidence from
material reality can demonstrate when natural selection does not occur.
It can, in fact, be demonstrated that not every change in organisms is
the result of natural selection; in fact most of the *observed*
differences (at the genetic sequence level of analysis, and even some
morphological differences) are not due to natural selection but to
neutral or near neutral drift.
> Fine, while at work... We're discussing science. It's all
> hinging on this, or possibly not. I am satisfied that anyone
> postulating an ID can use the same scientific evidence and point to
> plenty of things that appear to show or be in line with the actions of
> a designer.
What, specifically, *can't* be in line with the actions of an unknown,
unknowable designer hypothesized to have whatever powers one needs to
produce the observed results?
> In the context of hypothetical and postulated reasoning
> based on known science to this date and to this depth of understanding,
> are you willing to state that some evidence that you have seen is
> contradictory to an ID creation?
No, because that 'explanation' is so vague as to be untestable. Now,
if you were to specify exactly what you think "ID creation" involves
and present some testable consequence, we might approach your
hypothesis scientifically. Young Earth Creationists (Biblical
literalists) did this and science could and did reject the idea that
the fossil record supports a single creation event and that there was a
world-wide flood and all their other *specific, testable* ideas. IDs
entire raison d'etre is to avoid making any such testable claim.
> Or, is there some reason which
> "folks" should come to 'believe' that the answers are in and contrary
> to an ID?
I don't claim that ID is 'wrong'. There is no way to determine that,
given IDs avoidance of making any testable specific claims. I do claim
that, precisely because ID is intentionally vague and untestable, it is
not and does not belong in natural science. And I do claim that ID is
nothing but a fallback vernier of meaningless pseudoexplanation based
on the premise that "ignorance is knowledge", "gaps are good and
godly", and the huberis of thinking that one's own desires for
scientific evidence of one's personal god matters one frigging bit to
an empirical reality which provides no such evidence.
> I personally don't see the value to having a great portion
> of the scientific establishment act and write in a way which is
> dishonest and tries to say that this disproves a first cause. You are
> more honest than that, are you not?
Science makes no claim wrt the existence or non-existence of a "first
cause". It merely makes claims wrt exactly where and how (by what
mechanisms) such a thing, if it exists, did its work in the material
universe. Any "first cause" explanation that aims to be consistent
with science must accept standard science (including its admission to
being fallible and tentative rather than 'provable'), including both
the research on abiogenesis and evolution (in addition to cosmology).
Evolution is not an atheistic conspiracy; it is an attempt to
understand the mechanisms that account for the patterns of history in
biological organisms on this planet and to understand how organisms
adapt (change) to environments.
People who want their "first cause" to work the way that they want and
want it to work by mechanisms contrary to the mechanisms and methods
derived by people who study "material reality" simply don't like the
results and the mechanisms that such study demonstrates work in the
material world (to the extent that their current best approximation of
material reality is correct). They prefer the post-modernist idea that
they get to invent hypothetical entities to do whatever they want done
and get to use these hypothetical posited entities (or HYPEs) as
explanations that are less troubling than the explanations that arise
from the study of empirical reality. There is no science in ID. It is
an empty suit of an explanation.
hersheyhv
derdag wrote:
> Mujin wrote:
[snip]
> >
No one in science claims that abiogenesis is "solved" or "proven". But
abiogenesis is not evolution. Biological type evolution involves
changes in self-replicating systems that have genetic programs
(mechanisms for transmitting information to future generations). Such
systems (and you may or may not consider all such systems as 'alive')
are a precondition for biological type evolution.
> You don't use the terminology in the
> same way that they do, and You may lean toward open mindedness for new
> answers and less assumption in the future for abiogenesis. That is
> fine by me, as I am just as open to any real science myself. It is
> also true that anyone who thinks that it can be proven to have happened
> that way is wrong.
Science isn't in the "proving" business. "Proof" implies that an
absolute truth exists that we can capture by making a set of
propositions that are untestable themselves and logically determining a
conclusion based on those assumed propostions. "Proof" is for
mathematicians. Science can only produce explanations that are better
and better approximations of how material reality works. Thus all its
explanations are tentative and must continuously be able to be testable
against evidence from material reality. Scientific explanations do not
have to be "right". They do have to be "usefully wrong" or "wrong by
reference to material reality". ID fails this test. It may be
"right". It may even be "true". But it cannot be "usefully wrong"
until it can be tested to determine if it is "wrong" about something.
> This can not be proven, anymore than an ID can be
> proven. Until some evidence disproves that an ID had influence, or
> until it is proven that these circumstances could not have happened
> naturally, you will be open to and leaning toward that natural
> scenario.
What sort of evidence *could* possibly *disprove* the idea that some
unspecified, unknowable wrt material reality, undetectable something
that is asserted to be intelligent did something by some unobservable
mechanism to somehow produce whatever exists at some unspecified time
and unspecified place? How can ID be "usefully wrong"? If ID cannot
be "usefully wrong", it is not science; it is religious belief.
In contrast, natural selection can be usefully wrong. Evidence from
material reality can demonstrate when natural selection does not occur.
It can, in fact, be demonstrated that not every change in organisms is
the result of natural selection; in fact most of the *observed*
differences (at the genetic sequence level of analysis, and even some
morphological differences) are not due to natural selection but to
neutral or near neutral drift.
> Fine, while at work... We're discussing science. It's all
> hinging on this, or possibly not. I am satisfied that anyone
> postulating an ID can use the same scientific evidence and point to
> plenty of things that appear to show or be in line with the actions of
> a designer.
What, specifically, *can't* be in line with the actions of an unknown,
unknowable designer hypothesized to have whatever powers one needs to
produce the observed results?
> In the context of hypothetical and postulated reasoning
> based on known science to this date and to this depth of understanding,
> are you willing to state that some evidence that you have seen is
> contradictory to an ID creation?
No, because that 'explanation' is so vague as to be untestable. Now,
if you were to specify exactly what you think "ID creation" involves
and present some testable consequence, we might approach your
hypothesis scientifically. Young Earth Creationists (Biblical
literalists) did this and science could and did reject the idea that
the fossil record supports a single creation event and that there was a
world-wide flood and all their other *specific, testable* ideas. IDs
entire raison d'etre is to avoid making any such testable claim.
> Or, is there some reason which
> "folks" should come to 'believe' that the answers are in and contrary
> to an ID?
I don't claim that ID is 'wrong'. There is no way to determine that,
given IDs avoidance of making any testable specific claims. I do claim
that, precisely because ID is intentionally vague and untestable, it is
not and does not belong in natural science. And I do claim that ID is
nothing but a fallback vernier of meaningless pseudoexplanation based
on the premise that "ignorance is knowledge", "gaps are good and
godly", and the huberis of thinking that one's own desires for
scientific evidence of one's personal god matters one frigging bit to
an empirical reality which provides no such evidence.
> I personally don't see the value to having a great portion
> of the scientific establishment act and write in a way which is
> dishonest and tries to say that this disproves a first cause. You are
> more honest than that, are you not?
Science makes no claim wrt the existence or non-existence of a "first
er...@swva.net
> er...@swva.net wrote:
> > Nashton wrote:
> >> Perplexed in Peoria wrote:
> >>>> Nature's Jump-Starter
> >>>>
> >>>> By Phil Berardelli
> >>>> ScienceNOW Daily News
> >>>> 8 December 2006
> >>>> How in the world did life emerge on a planet composed only of simple
> >>>> chemical compounds? Scientists say they may have found part of the
> >>>> answer in a mineral that seems to act as an effective catalyst for the
> >>>> earliest organic processes.
> >>>>
> >>>> makes energy using the same biochemical pathway. Called the Krebs--or
> >>>> citric acid--cycle, this series of chemical steps converts
> >>>> carbohydrates, fats, and proteins into energy that powers cellular
> >>>> activities. To figure out how the Krebs cycle got started, scientists
> >>>> have been working backward to identify the nonorganic materials that
> >>>> originally helped set the cycle in motion.
> >>>>
> >>>> Reporting in next week's Journal of the American Chemical Society,
> >>>> researchers at Harvard University say they may have found at least one
> >>>> of the original players. Called sphalerite, the compound is a mix of
> >>>> zinc and sulfur ejected from hydrothermal vents and known to have been
> >>>> plentiful in Earth's early seas. Geochemist and co-author Scot Martin
> >>>> says the team's new lab experiments show that when immersed in sterile
> >>>> water and exposed to sunlight, sphalerite can create three of the five
> >>>> basic organic chemicals necessary to start the Krebs cycle in
> >>>> relatively quick fashion. Further research is needed to isolate the
> >>>> other compound or compounds that could have produced the remaining two
> >>>> Krebs ingredients, he notes. If scientists can find their sources, then
> >>>> they will know that the five chemical foundations of the Krebs cycle
> >>>> were being manufactured easily and routinely in Earth's early oceans.
> >>>>
> >>>> It's "elegant" research, says mineralogist Robert Hazen of the Carnegie
> >>>> Institution in Washington, D.C. The idea that sphalerite can catalyze
> >>>> three of the five Krebs cycle basic compounds all by itself is "an
> >>>> exciting result ... [that brings us] a lot closer to understanding the
> >>>> chemical origins of life."
> >>> http://pubs.acs.org/cgi-bin/abstract.cgi/jacsat/asap/abs/ja066103k.html
> >>>
> >>> It appears that Berardelli badly garbles the story. Sphalerite doesn't
> >>> "catalyze three of the five Krebs cycle basic compounds all by itself".
> >>> It catalyzes three of the reductive steps in the pathway. There are more
> >>> than five compounds involved in the cycle.
> >>>
> >>> The interesting reaction is the one from oxoglutarate (2KG) to oxalosuccinate.
> >>> That one is one of the key reactions adding carbon to the skeleton. I'm
> >>> curious whether this reaction (and the one from oxaloacetate to malate)
> >>> exhibit chiral specificity. Seems doubtful, since the mineral itself is
> >>> not chiral. Also interesting is that natural sphalerite almost always has
> >>> ferrous iron as a variable substituent for the zinc. Tiny microcrystals
> >>> of iron sulfide in the same cubic arrangement as in sphalerite play a big
> >>> part in almost all microbial redox reactions.
> >>>
> >>
> >> Now if only we can solve the mystery of how glucose was readily
> >> available in order to be catabolised in the first place. Unless
> >> scientists believe that pyruvate existed in nature without its
> >> precursor, glucose.
> >>
> >> Dunno about you, but I consider the manufacture of glucose vastly more
> >> important than its breakdown. Moreover, when we fully figure out the
> >> mechanism by which light actually splits water in PS, I'll be impressed.
> >>
> >> In the meantime, grasping for straws is all we're going to get from the
> >> scientists that are hell-bent on attempting to prove that abiogenesis
> >> actually occurred.
> >>
> >
> > I don't think they are trying to prove that it occurred;
>
> I think they are trying to prove that it occurred in a random fashion.
>
> HTH
>
> we already
> > know that life came about from non-life at some point because there is
> > no basis for thinking that it always existed. What scientists are
> > doing is trying to figure out _how_ it could have come about.
>
> Says who? Maybe life and matter have existed since the Universe began?
Well, how would that work?
> Maybe God created life as per Genesis.
What would be the chances of that? Why select one traditional
supernatural explanation over any other? Better to just stick to
science.
> Can you prove otherwise?
Why bother? Neither of those explanations is even in the running.
>
>
> Short answer: No.
So what?
>
>
>
> --
>
> Nicolas
>
Eric Root
Ken Denny
> Until some evidence disproves that an ID had influence,
Is there any possible evidence you can imagine that would do that?
That's the problem with ID. No matter what evidence is found, it is
consistent with ID.
Larry Moran
[snip]
> Now if only we can solve the mystery of how glucose was readily
> available in order to be catabolised in the first place. Unless
> scientists believe that pyruvate existed in nature without its
> precursor, glucose.
Glucose wasn't present. The gluconeogenesis pathway clearly came
first and the glycolytic pathway evolved from it after glucose became
plentiful.
There are still some species of bacteria that don't have the standard
glycolytic pathway but all of them have the enzymes for making glucose
(gluconeogenesis).
> Dunno about you, but I consider the manufacture of glucose vastly more
> important than its breakdown. Moreover, when we fully figure out the
> mechanism by which light actually splits water in PS, I'll be impressed.
Be impressed. We're almost there.
Larry Moran
Larry Moran
<jimme...@sbcglobal.net> wrote:
> "John Vreeland" <vree...@yahoo.com> wrote in message
> news:1165620737....@80g2000cwy.googlegroups.com...
>> Nature's Jump-Starter
>>
>> By Phil Berardelli
>> ScienceNOW Daily News
>> 8 December 2006
>> How in the world did life emerge on a planet composed only of simple
>> chemical compounds? Scientists say they may have found part of the
>> answer in a mineral that seems to act as an effective catalyst for the
>> earliest organic processes.
>>
>> Every organism on Earth, from the smallest bacterium to the blue whale,
>> makes energy using the same biochemical pathway. Called the Krebs--or
>> citric acid--cycle, this series of chemical steps converts
>> carbohydrates, fats, and proteins into energy that powers cellular
>> activities.
This is not correct. Most bacteria do not have a complete Krebbs cycle.
It's not one of the primitive metabolic pathways. The various steps
evolved from other pathways, mostly amino acid biosynthesis.
Larry Moran
derdag
I hear that recent ID guys use a marker to identify their work, much as
song writers or software copywriters do.
No matter why hacks and changes the genes, it is evolution to
evolutionists, unless they put their marks in for identification
purposes.
Mujin
der...@chilledwatertech.com says...
So where should geneticists look for "watermarks" and why? This is
something I don't think I've ever heard discussed by ID authors who
propose watermarking as a possible evidence for design.
derdag
I don't know if you're just tired, Eric, or what. You never have
any descriptive substance to any of your posts. It's almost as though
you don't have the background to enter into a reasonable debate about
any of this material. It isn't as if I have had to post data or
anything to counter your post, because there is never anything but
belief in them. Maybe you have had some college level science, but
your posts don't indicate it.
derdag
John Vreeland wrote:
> On Sat, 09 Dec 2006 22:42:26 -0800, Michael Siemon
> <mlsi...@sonic.net> opined:
>
> >In article <1165732451.3...@79g2000cws.googlegroups.com>,
> > "derdag" <der...@chilledwatertech.com> wrote:
>
> >> And, it's congruent with ID.
> >
> >Since ID deliberately says nothing at all, anything is congruent with ID.
>
> I was going to take offense at that statement, but I just realized it
> is true. You cannot disprove ID.
>
> I had forgotten that. It is sort of funny.
>
> ID is true in the same way that it might be true that Derdag is really
> a very wise person who simply plays a perfect fool for his own
> amusement.
You can't disprove that change over time happens, as in the ToE. I
guess that the same science using the same data lead to the same
unknowns. Or, should we say that the same data leads to different
beliefs?
hersheyhv
derdag wrote:
> John Vreeland wrote:
> > On Sat, 09 Dec 2006 22:42:26 -0800, Michael Siemon
> > <mlsi...@sonic.net> opined:
> >
> > ID is true in the same way that it might be true that Derdag is really
> > a very wise person who simply plays a perfect fool for his own
> > amusement.
>
> You can't disprove that change over time happens, as in the ToE.
I certainly agree that the idea that change in biological systems
occurs has not yet been falsified or disproved. That is to be expected
if it is a true reflection of the way that empirical reality works.
But the fact is that you could, at least in principle, do so.
*If* there were no change over time, fossils from the lowest levels of
the geologic strata would be identical to the fossils from the highest
levels. They aren't. Therefore, stasis of biological systems is
vanishingly unlikely.
Or *if* there were no change over time, then there must be no
mutational events because mutation means change. Mutational events
are regularly observed. Therefore, any stasis that exists in
biological systems must be a dynamic stasis produced post-mutational
selection acting on variation. In the absence of selection (as in
selective neutrality) stasis is simply impossible.
Failure to falsify a theory that, in principle, is falsifiable tells us
that we scientists are on the right track in our explanations. What
does it tell you?
OTOH, a theory that is not, in principle, falsifiable, is
scientifically worthless.
> I
> guess that the same science using the same data lead to the same
> unknowns. Or, should we say that the same data leads to different
> beliefs?
> >
> > --
> > My credentials? I have _excellent_ karma on Slashdot.
> > ---John Vreeland (Vreejack)I
derdag
Here's one idea of a hypothetical idea just off of the top, for
discussion purposes that might be completely wrong, but who cares?
I might see that a chimp and human have hair. The ToE common
ancestor would have had hair. The genes which code for hair, the
muscles attached to the follicle, the pigments in the hair, the dermal
layers from which the hair emerges, the thickness, etc. are all part of
the integumentary system. Now, If these traits are on five different
chromosomes in the chimp, but on five other chromosomes in humans, it
might be more congruent with ID than if all of the code for all of the
traits involved came from the same corresponding chromosomes in man and
in chimp. We could even delve into shorter segments of code which are
involved with these structures than entire genes or chromosomes. When
it is found that all hairs must have certain chunks of genetic code
which are UCRs, but that variable code sections make up the variations,
and that the UCRs are on entirely different chromosomes in such closely
related species, it would not be ToE friendly.
I'm looking for obvious relative species, or what the ToE would call
closely related by their meaning of related, that have the pieces of
UCRs in their chromosomes but placed in completely different locations
with respect to the ways in which the sequence is is read in the close
relative. It might be there, but jumbled, cut and read entirely
differently.
A wood stump is a chair. A four legged chair is a chair. A four
legged chair with a back and glued is a chair. A house is made of
wood. A wooden boat is descended from chair. An ocean liner still has
wood railings, so it's common ancestor is a stump.
Step by step, random mutation, selected by nature would not predict
highly variable code arrangements in single chromosomes or especially
if the various coordinated structures of a system like hair were found
to reside in a single location in one species and all over the map in
another closely related species. That wouldn't be ToE friendly, IMO.
I don't do the analysis, so I just check in about every 7yrs or so
to see what new findings support my past predictions.
derdag
Is a theory falsifiable if the terminology used to describe it is so
inclusive that the theory doesn't describe any variables, and is in
that way unfalsifiable?
I'm going to see if I can figure out a way to disprove ID. It will
probably be just as difficult to offer a method to disprove ToE, but
saying that the ToE doesn't isolate against the ID is certainly good
enough, and it always has been.
OK. Here it is. ID can be removed from possibility if there is
anything random about mutation and natural selection.
If a random pattern of mutation and natural selection were operating,
we would see just as much divergence back to more primitive forms from
more complex species, back to toward ancestral things which worked
previously, or like them from more advanced forms in lineages of
species.
hersheyhv
Unfortunately for your position, the results are already known for many
genes. If you compare the great ape chromosomes by looking at banding
patterns (bands seen by using specific stains, which would only show up
large scale differences), you will see that some large regions on
specific chromosomes have undergone translocations and inversions.
This results, sometimes, with a region on, say, chromosome 2 of
chimpanzees being on a differently numbered human chromosome. But the
regions are still homologous, and if you look at, say gene A, which is
flanked by B and C in humans, you will find, in almost all cases
(except at the exact breakpoints where there has been duplication,
deletion, inversion, or translocation), that A is flanked by genes B
and C in the correct order in the other ape species. By simple
induction from the *observed cases* where such a relationship holds, it
is very unlikely that genes for hair are randomly scattered and in
radically different places in the genome in any of the great apes.
The original chromosome level banding work was done by Yunis JJ, Sawyer
JR, Dunham K: The striking resemblance of high-resolution G-banded
chromosomes of man and chimpanzee.
Science 1980, 208:1145-1148.
As described more recently:
http://genomebiology.com/2003/4/8/R50
Primarily examined through the use of G-banding cytogenetic techniques,
the human and common chimpanzee karyotypes differ by only 10
euchromatic rearrangements: a telomere fusion between PTR chromosomes
12 and 13, resulting in HSA chromosome 2, and 9 pericentric inversions
(HSA 1, 4, 5, 9, 12, 15, 16, 17, 18) [1,2]. The predominance of
pericentric inversions between chimps and humans highlights their
potential importance in the divergence of human from non-human primate
species, and provides an opportunity to investigate the mechanism
facilitating these rearrangements. Recent studies have characterized
several evolutionary breakpoints in common chimpanzee and other great
ape species including pericentric inversions and a chromosome
translocation [7-9].
And looked at at the midlevel of analysis:
http://www.genome.org/cgi/content/full/13/3/347
> We could even delve into shorter segments of code which are
> involved with these structures than entire genes or chromosomes. When
> it is found that all hairs must have certain chunks of genetic code
> which are UCRs, but that variable code sections make up the variations,
> and that the UCRs are on entirely different chromosomes in such closely
> related species, it would not be ToE friendly.
And the fact remains that such a discovery has not been seen in all the
genes that have actually been examined.
> I'm looking for obvious relative species, or what the ToE would call
> closely related by their meaning of related, that have the pieces of
> UCRs in their chromosomes but placed in completely different locations
> with respect to the ways in which the sequence is is read in the close
> relative. It might be there, but jumbled, cut and read entirely
> differently.
Again, there are inversion and translocation differences in the great
apes (but not a large number relative to other speciation events). But
finding that such an *observable* (in the present chromosomes) event
like a translocation separated two genes is hardly newsworthy and would
not result in a random (or even semi-random) placement of specific
genes.
> A wood stump is a chair. A four legged chair is a chair. A four
> legged chair with a back and glued is a chair. A house is made of
> wood. A wooden boat is descended from chair. An ocean liner still has
> wood railings, so it's common ancestor is a stump.
>
> Step by step, random mutation, selected by nature would not predict
> highly variable code arrangements in single chromosomes or especially
> if the various coordinated structures of a system like hair were found
> to reside in a single location in one species and all over the map in
> another closely related species. That wouldn't be ToE friendly, IMO.
And, alas for your position, for *real* genes (unlike your hypothetical
example) where such research *has been done*, we find ToE-friendly
results. And no reason (entire genomes has been sequenced) to expect
to find any significant number of unfriendly ones in the future. If
unfriendly to ToE results were anything but exceedingly rare, it would
have already been spotted.
hersheyhv
What terms are you thinking about? "Design", "complexity",
"information"? Or "natural selection", "mutation"? The former, as
used by IDeologues, clearly do not describe anything specific or are
used inconsistently or without adequate specification. But natural
selection is defined such that I can tell you *when* it does not occur.
And I know and correctly use 'mutation' to mean change rather than
evil, bad, nasty, unpleasant change whereas creationists almost always
add that extra baggage to the term.
> I'm going to see if I can figure out a way to disprove ID. It will
> probably be just as difficult to offer a method to disprove ToE, but
> saying that the ToE doesn't isolate against the ID is certainly good
> enough, and it always has been.
Huh? What the frig does "doesn't isolate against the ID" mean? I can
give any number of expectations, had they not been observed, would have
meant that some other explanation of current bioforms would be
necessary. That they were observed means that we scientists are
probably on the right track because the expectations are specific and
the theory is potentially falsifiable by reference to evidence for or
against these expectations. I can't come up with a comparable specific
expectation for ID because ID is not a testable mechanism. It is an
unobservable, untestable something that is asserted to do something at
some time and some place to somehow by some unspecified mechanism
produce whatever exists.
>
> OK. Here it is. ID can be removed from possibility if there is
> anything random about mutation and natural selection.
Mutation (variation production) is, indeed, testably random wrt need.
Natural selection, however, as might be expected given the word
"selection" is not random at all.
> If a random pattern of mutation and natural selection were operating,
> we would see just as much divergence back to more primitive forms from
> more complex species, back to toward ancestral things which worked
> previously, or like them from more advanced forms in lineages of
> species.
And, indeed, the evidence indicates that there is in no real sense any
"progress" toward greater complexity, but only adaptation to local
conditions. Under certain circumstances, such adaptation leads to more
complexity measured in number of functioning genes (the amount of
complexity involved is always greatly exaggerated, as essentially all
vertebrates have roughly the same number of coding sequences and it is
but a small factor of increase -- a doubling or less -- over the number
of genes in other multicellular eucaryotes, and most of that involves
duplications). In fact, the number of genes in humans is less than an
order of magnitude (10-fold) greater than the number of genes in E.
coli). In other circumstances, especially as adaptation to parasitism,
it leads to a loss of complexity -- simplification of form and reliance
on the host for metabolism.
Being the egocentric species-centrists that we are, we naturally think
(well, think without actually thinking) that we are some inevitable
consequence of events and are the most complex of all organisms by a
large amount. There is no evidence to support that supposition that I
am aware of.
Mujin
der...@chilledwatertech.com says...
Dr.Hershey has already given some detail regarding why this doesn't
work as evidence counter to ToE by common descent, so I won't go
into it.
Assuming that the pattern you describe actually *did* occur in
nature, though, I don't see how it would prove "technogenesis" or
"deogenesis" - at best it would show that our conception of common
descent is incorrect. This would not eliminate (as an absurd
example) spontaneous generation of modern animals or the possibility
that closely related gene clusters we assumed were transmitted by
common descent are actually capable of independent movement between
species by some process we haven't yet detected.
Yes, it would eliminate the use of closely related genes as evidence
for common descent (and might well disprove the idea that living
things evolve by descent with modification) but it wouldn't
automatically imply that technogenesis or deogenesis is correct.
In any case, this is not what I understood you to mean by
"watermarking" in genomes. Your reference to genetic engineers and
the watermarks they insert to identify their work led me to believe
that you were referring to an unambiguous mark present in many
distantly related species.
Isn't this what you meant? If it *is* what you meant, then where
should geneticists look for things like this, and how could we
distinguish between a watermark and a common pattern of mutation?
[snip]
derdag
Well, I didn't mean that the ID wrote "Hi, It's Me, I Am!"
>
> Isn't this what you meant? If it *is* what you meant, then where
> should geneticists look for things like this, and how could we
> distinguish between a watermark and a common pattern of mutation?
I'm beginning to think that unless we find some DNA for down line
ancestors, that nothing will be that sure. And, it isn't likely that
we will find enough of it from long enough in the past to be quite
certain about it. That's why beliefs have been so popular within the
athiest community.
>
> [snip]
Mujin
No, of course not, but for it to be evidence of ID it would have to
be clear and unambiguously inserted - either ubiquitous or present
in all of a particular set of organisms.
Perhaps something mathematical or palindromic which codes for
nothing useful but is nevertheless marked out with identical start
and stop codons.
Unfortunately, drift being what it is such a watermark wouldn't
survive very long, unless it were being periodically reinserted or
somehow maintained. The reason commercial genetic watermarks are
useful is tied to the fact that they're dealing with a limited
number of generations.
>
>
> >
> > Isn't this what you meant? If it *is* what you meant, then where
> > should geneticists look for things like this, and how could we
> > distinguish between a watermark and a common pattern of mutation?
>
> I'm beginning to think that unless we find some DNA for down line
> ancestors, that nothing will be that sure. And, it isn't likely that
> we will find enough of it from long enough in the past to be quite
> certain about it.
We don't need to be certain - we just need enough to strongly
suggest interference from an outside agent. And of course the
interference needn't be universal - finding such a tag only in
strategic organisms such as in humans and our domesticates would be
enough.
> That's why beliefs have been so popular within the
> athiest community.
Is there something missing from this sentence? It seems incomplete.