Sainsbury Humiliate Customers With 'Over 25 Age Rule'.
Turk182
branch where they usually get served without a hitch, today it was
decided that both customers looked under 25 and so asked for proof of
age.
The two smartly dressed working men, one of them of Chinese
appearance, were challenged when the person serving them decided to
invoke the company's 'Under 25 rule'.
The men, who were embarrassed at being told in front of a queue of
customers that they could not buy a six pack of beer along with their
food shopping, moved to the customer service area to complain. Once
there, they were given the standard company response, (being further
embarrassed in front of the waiting queue of Sainsbury's gamblers,
smokers and sugar addicts).
Whether or not you agree with the policy of asking people who seem to
be under 25 to ONE of their staff members (because there is no debate
on age between staff members), one thing that should cause concern, is
the inconsistency of opinion.
The likelihood of a person over 25 years of age being humiliated and
challenged in this way is high. A 30 year old woman buying a video or
Christmas Crackers is just as likely to be challenged as a 17, a 23 or
25 year old. However, they may all get a different response on a
subsequent visit, depending on who serves them.
Whatever Sainsbury actually try to convey in their publicity i.e.:
they say, "Take it as a compliment"; what they are actually saying is,
"we believe there is a chance, based on your appearance, that you are
not telling us the truth about your age".
By virtue of the fact that you have shopped there many times and have
NOT been challenged, having already been regarded as eligible to buy
alcohol from the store, I think that the 'change of heart' towards you
personally, amounts to a form of discrimination; certainly humiliation
and that this incident could be seen by others nearby, as you
attempting to 'be dishonest' over the detail of your true age.
In other words, I, if I were 'lucky enough' to look under 25, I may,
if I were these guys, seriously consider pursuing the company for
compensation.
Having an eye-witness who can testify that you looked 'extremely
embarrassed and humiliated' should be enough to clinch it.
Chinese people often look younger than people from other western
countries for example, so does this rule discriminate against them in
particular?
People from Belgium also get a rough ride, because according to one
account, a Belgian ID Card was not accepted as evidence of age. The
customer was told they would need a BRITISH Passport or driving
licence.
http://www.kosmopolito.org/2009/12/11/sainsburys-does-not-accept-id-cards/
You may think this story is just a bit of fun, but it is not. It is
extremely humiliating when men who could die for their country are
refused a can of beer in a store, or when a woman in the queue is
challenged, when the local teenage girl in front goes through ok. No
Sainsbury. This is not a big laugh - accept for you perhaps!
The issue here is not that the company don't have a 'right' to
challenge people who LOOK (to them) to be under 25. The issue is, are
the staff going to take this right to the point of making you appear
to be lying in front of their customers; particularly when you tell
them loudly "I am over 25", and they say by their actions, "we think
you may not be telling us the truth"? I suggest that it is the issue
of one's honesty which needs to be challenged, rather than any other
aspect.
Contrary to Sainsbury's assertion, people are clearly not flattered to
be told they look under 25 and cannot therefore buy beer because they
have no identification.
The hypocrisy is that Sainsbury sell, highly inflammable, explosive
fluid to people who look 14, when they drive their mopeds on to their
petrol forecourts - suddenly, the moral crusader role is ditched in
the interests of a quick sale.
It is also interesting to see how this rule, common to those of a
number of store chains, came about, while Labour were in the process
of making us all carry I.D cards. No doubt the breathy whispers of
Mandleson & Co had reached the ears of the directors of the firms
involved - who obliged for some kind of advantage of their own.
By the way, the staff member in question looked under 17. Upon asking
staff on behalf of the IP's the question, "can the staff member prove
his age?", I was told that Sainsbury policy is, that no member of
staff is allowed to carry any item that could identify them. In other
words, Sainsbury could be selling you alcohol with the salesperson
involved being UNDER the legal age to do so, and you would have no way
of avoiding being involved in this particular heinous offence.
Solutions to the age of staff issue. When a young member of staff
attempts to sell you a restricted item in Sainsbury, insist they get
someone else to carry out the sale. After all, a little bit of
embarrassment doesn’t hurt anyone ....does it!
Here; a full list of age restricted products:
I felt moved to write this today, because I am communicating the
degree of anxiety felt by the Sainsbury customers involved.
Turk182
Phister
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
MM
<digital...@aol.com> wrote:
>I felt moved to write this today, because I am communicating the
>degree of anxiety felt by the Sainsbury customers involved.
Quite right, too. I've a mind to write to Justin King again. Oh, if
only I was 25 again and looked younger, I'd have a field day with
fucking Sainsbury's! They'd have to employ extra staff to move all the
bottles back to the shelves after I had been refused purchase. A
trolleyful one day, another trolley the next... hmmm. Why don't a few
unemployed people with time on their hands get together and have a
right laugh at this fascist attitude now rife in supermarkets?
MM
allantracy
The biggest part of the problem with kids and booze today is that some
pratt decided to take the eighteen year old limit seriously whereas
previously, in practice, it operated much more as a guideline, even a
suggestion.
In my day, admittedly some years back, I once got served to cider
wearing my school uniform.
Age id didn’t exist in those days and basically if you looked old
enough you got in and got served, not too many questions asked.
Consequently, it was not unusual for girls as young as fifteen to
frequent city centre discos and personally I was still sixteen when I
first stated drinking regularly in pubs.
The great advantage of all this was that the kids did their drinking
in a supervised environment, whether it be the landlord or the
bouncer, and you pretty quickly learnt to do as you were told and not
to be so stupid.
Kids nowadays get all of their booze either through a compliant third
party or more likely from contraband (white van man has no rules) and
then do all their drinking, usually into oblivion, on some street
corner with no guidance whatsoever.
Gareth
On 11/09/2010 20:04, Turk182 wrote:
> Two Sainsbury's customers were humiliated this afternoon, when at the
> branch where they usually get served without a hitch, today it was
> decided that both customers looked under 25 and so asked for proof of
> age.
I got challenged in Tesco a while ago. I assumed the checkout girl would
realise how stupid she was when I pulled out my paper driving licence
(which itself is nearly old enough to buy alcohol) but no, she then
refused to serve me because my wife didn't have Id.
I don't think we can really blame the supermarkets though as they get
into a lot of trouble if they get caught selling things to under-age
people and it is very hard to judge age. One thing I can't understand
though is why they wont accept a credit card as proof of age - you can't
have a credit card if you are <18 so anyone paying for booze with a card
should be ok.
Anyway, I've seen worse abroad - my dad was asked for Id. in New Jersey
and he has been retired for a long time!
Turk182
> On Sat, 11 Sep 2010 12:04:29 -0700 (PDT), Turk182
>
Agreed! You and me too.
If students organised themselves on this one; things could soon get
tricky for such companies. Even a leaflet campaign would cause
problems.
Phone cameras filming incidents of 'young looking people' going
through tills without being challenged, could result in allegations of
discrimination.
The wording of the Sainsbury campaign is designed to head off legal
challenge, but it's effectiveness in law may be an illusion. They
have admitted that they discriminate against people 'looking' as if
under 25. (These people MUST bring documents to buy certain goods or
risk humiliation.)
(The implied insult to under 25's that don't get stopped is that they
look old for their age!)
What about people just turned 26 who buy Sainsbury's "Age Reversal"
products?
Can customers buying the above product sue if after using it, they are
subsequently not challenged for 'looking under 25'?
Looking at the company directors, we learn that Anna Ford has found
her way into the board room. She has obviously lost her skills of
sniffing out a story, yet visually, seems to have undergone age
reversal for the Sainsbury photo! Perhaps we need to catch her near
her local branch of Sainsbury and challenge her to prove that she is
really under 80. But, we wouldn't want to embarrass her would we :-)
http://www.j-sainsbury.co.uk/ar06/boardofdirectors/ford.shtml
Meanwhile, Taste the Difference here on what really happens in a
Sainsbury branch, compared to their 'overly responsible' facade. In
this Kent branch it seems that the Under 25 rule certainly doesn't
apply, as among the staff, who would no doubt be challenging you for
the lack of obvious crinkles in your face, is a reference to one who
appears to be applauding a sex act with a 14 year old!
http://www.youtube.com/watch?v=oNADa3PYgRE
These are the Sainsbury's 'policemen and women' who want to inspect
your personal information!
Turk182
Turk182
We should do what they do. Challenge and LOUDLY!! Politeness never
won a war against discrimination.
Turk182
Alex Heney
<snip>
>I felt moved to write this today, because I am communicating the
>degree of anxiety felt by the Sainsbury customers involved.
No, you felt moved to write it because you are a poor oversensitive
soul who is constantly "humiliated" by things which any normal person
would see as a complete triviality.
And most people who are over 25 would feel quite flattered to be
thought under it, rather than feeling "humiliated" by it.
--
Alex Heney, Global Villager
Professionals built the Titanic, amateurs built the ark.
To reply by email, my address is alexATheneyDOTplusDOTcom
Turk182
> On Sat, 11 Sep 2010 12:04:29 -0700 (PDT), Turk182
>
Like this Bank Manager for example? Another "poor over sensitive
soul" too eh Alex!
Turk182
R. Mark Clayton
"Phister" <phi...@inbox.com> wrote in message
news:Taednf-JZpENQRbR...@bt.com...
PS worked wonders years ago when the Coop wouldn't weigh up some onions just
before closing and they had tilled in a full trolley.
MM
Here's one comment to that DM story:
"I've been refused alcohol several times and I'm 34. If you are
'humiliated' by this then you really need thicker skin.
If some thing had been sold to an underage person you would be livid,
shop assistants can't win."
However, that comment has so far attracted 611 red (worst rated) marks
against it, so that just goes to show, extrapolating, what the vast
majority of the public think about this ridiculous dogma.
MM
Paul Hyett
in uk.legal :
>Two Sainsbury's customers were humiliated this afternoon, when at the
>branch where they usually get served without a hitch, today it was
>decided that both customers looked under 25 and so asked for proof of
>age.
I don't understand why *25* anyway - you only need to be 18 to buy
booze...
--
Paul Hyett, Cheltenham
Djornsk
The rule is not part of a watertight comprehensive set of measures to
prevent under 18s throughout the country obtaining alcohol so what is
the point? Why antagonise people to make one small link 100%?
Covering a...s is understandable to a point but the dominant ethos of a
retailer should be to push the limits to SERVE the customer with what he
or she wants. It's one thing acting within the law but quite another to
take on the role of policing and patronising customers with such
apparent relish.
j
Mr. Benn
news:8f3djd...@mid.individual.net...
The problem is that the retailers get punished very hard if caught selling
to under eighteens. That can include having their license to sell alcohol
revoked so I can understand the amount of caution used.
If you look anywhere near 18 or under, you should carry some ID when buying
alcohol. Retailers reserve the right to refuse to sell to anyone.
Gareth
On 12/09/2010 07:59, Paul Hyett wrote:
To give some margin for error. It's very hard to judge age and a 17 year
old could easily look a lot older than 18.
Gareth
On 11/09/2010 22:28, Alex Heney wrote:
> On Sat, 11 Sep 2010 12:04:29 -0700 (PDT), Turk182
> <digital...@aol.com> wrote:
>
> <snip>
>
>> I felt moved to write this today, because I am communicating the
>> degree of anxiety felt by the Sainsbury customers involved.
>
> No, you felt moved to write it because you are a poor oversensitive
> soul who is constantly "humiliated" by things which any normal person
> would see as a complete triviality.
>
>
> And most people who are over 25 would feel quite flattered to be
> thought under it, rather than feeling "humiliated" by it.
I largely agree with you but it does present some practical problems if
you don't have any Id. which they will accept. I initially felt
flattered but then became annoyed, though not humiliated as I'm sure the
people in the long cue behind me could see that it was the checkout girl
being stupid by refusing to sell alcohol to someone with greying hair.
John Turner
"Phister" wrote
> I would have left my trolley of shopping with the cashier and walked out.
I'd have tipped it on the floor & walked out.
John.
Alex Heney
<digital...@aol.com> wrote:
>On 11 Sep, 22:28, Alex Heney <m...@privacy.net> wrote:
>> On Sat, 11 Sep 2010 12:04:29 -0700 (PDT), Turk182
>>
>> <digitalradi...@aol.com> wrote:
>>
>> <snip>
>>
>> >I felt moved to write this today, because I am communicating the
>> >degree of anxiety felt by the Sainsbury customers involved.
>>
>> No, you felt moved to write it because you are a poor oversensitive
>> soul who is constantly "humiliated" by things which any normal person
>> would see as a complete triviality.
>>
>> And most people who are over 25 would feel quite flattered to be
>> thought under it, rather than feeling "humiliated" by it.
>> --
>> Alex Heney, Global Villager
>> Professionals built the Titanic, amateurs built the ark.
>> To reply by email, my address is alexATheneyDOTplusDOTcom
>
>Like this Bank Manager for example? Another "poor over sensitive
>soul" too eh Alex!
>
Yes.
Not that I could see any direct quotes from him saying he felt
"humiliated", so it is possible the Mail made that bit up.
And why feel the need to post a link to something from over a year
ago, which doesn't really add anything?
--
Alex Heney, Global Villager
With friends like these, who needs to hallucinate?
Alex Heney
I can quite see that it could be very annoying if you didn't have any
form of ID with you.
It was his suggestion that it would be "humiliating" that I was
arguing against.
--
Alex Heney, Global Villager
I am free of all prejudice. I hate everyone equally.
Alex Heney
Indeed.
I remember my 12 year old daughter being take for 16+ when I went for
a meal once with her (plus my Wife and sister-in-law), so she was
asked if she was drinking wine as well when we ordered a bottle.
If 12 can be mistake for 16, then I am sure there are 16-17 year olds
out there who look like 20.
--
Alex Heney, Global Villager
Why doesn't the Bat Computer ever crash?
Turk182
>
> - Show quoted text -
Here is another humiliated Sainsbury customer (over another matter
this time).
http://www.bbc.co.uk/news/uk-england-merseyside-10956763
Turk182
Mike Ross
>On Sat, 11 Sep 2010 12:04:29 -0700 (PDT), Turk182
><digital...@aol.com> wrote:
>
><snip>
>
>>I felt moved to write this today, because I am communicating the
>>degree of anxiety felt by the Sainsbury customers involved.
>
>No, you felt moved to write it because you are a poor oversensitive
>soul who is constantly "humiliated" by things which any normal person
>would see as a complete triviality.
>
>
>And most people who are over 25 would feel quite flattered to be
>thought under it, rather than feeling "humiliated" by it.
I'm not sure I agree. To me it carries a significant imputation of dishonesty:
'well you SAY you're over 18 but I think there's a chance you're a liar' is the
bottom line of what they're saying when they demand ID. That's not an acceptable
way to treat customers. Mr. Turk is making quite a meal of it but I see where
he's coming from, and I don't entirely disagree.
Mike
http://www.corestore.org
'No greater love hath a man than he lay down his life for his brother.
Not for millions, not for glory, not for fame.
For one person, in the dark, where no one will ever know or see.'
AndyW
"Turk182" <digital...@aol.com> wrote in message
news:efa2cf02-a30c-4a13...@c21g2000vba.googlegroups.com...
Two Sainsbury's customers were humiliated this afternoon, when at the
branch where they usually get served without a hitch, today it was
decided that both customers looked under 25 and so asked for proof of
age.
My son (14 years of age at the time) was refused a computer game because he
did not have proof of age. All very laudable, the supermarket is protecting
children except that this was a Wii Lego Star Wars game with a PEGI rating
of 3 years or more. Anyone who is not capable of noting the difference
between a 2 year old and a spotty, lanky teenager with his own bank card
need their eyes looking at.
Tesco have a strange attitude to alcohol. I have seen adult clearly over 18
asked for ID by an under 18 on the till who then shouted for a colleague to
oversee the transaction (collegaue behind did not even look, just said
"OK").
It clearly does not work both ways.
Andy
Gareth
That rule does seem pointless. It's even worse at the pharmacy in Tesco
- a while ago I wanted to by some paracetamol, there was none left on
the shelf but some behind the pharmacy counter. However when I tried to
buy a pack I was told that the pharmacist was not there so I would have
to wait. I waited a few minutes and a bloke in a white coat walked past
and went straight to the back of the pharmacy without saying anything or
even looking at me. The woman then gave me the paracetamol.
> It clearly does not work both ways.
No but do you really want it too? I mean in your above example should
the adult have refused to buy the alcohol until a member of staff over
the age of 18 and with Id to prove it was available?
MM
wrote:
>On Sun, 12 Sep 2010 10:13:34 +0100, Gareth <m...@privacy.net> wrote:
>
>>
>>On 12/09/2010 07:59, Paul Hyett wrote:
>>> On Sat, 11 Sep 2010 at 12:04:29, Turk182 <digital...@aol.com> wrote
>>> in uk.legal :
>>>
>>>> Two Sainsbury's customers were humiliated this afternoon, when at the
>>>> branch where they usually get served without a hitch, today it was
>>>> decided that both customers looked under 25 and so asked for proof of
>>>> age.
>>>
>>> I don't understand why *25* anyway - you only need to be 18 to buy booze...
>>
>>To give some margin for error. It's very hard to judge age and a 17 year
>>old could easily look a lot older than 18.
>
>Indeed.
>
>I remember my 12 year old daughter being take for 16+ when I went for
>a meal once with her (plus my Wife and sister-in-law),
Only because she was dressed like a 16+ year-old. 12-year-old girls
wearing no make-up or tight jeans or low tops or any of the other
paraphernalia that they all choose to make them look older, look like
12-year-olds.
I recall an ITV programme similar to Lads' Army in which a group of
15-year-olds were taken back to the 1950s and had to remove all their
accoutrements of modern life, like piercings, make-up, and 'come on'
apparel, and were then dressed as they would have been back then. The
difference, especially in the case of the girls, was stark. Suddenly
they looked like vulnerable children again -- and *they* were 15,
not 12!
MM
Big Les Wade
>It was his suggestion that it would be "humiliating" that I was
>arguing against.
I can easily see how one might feel humiliated, if one waa forced to
walk away empty handed after being refused alcohol by a checkout girl.
You've lost a public argument, you've had to admit defeat, you've got to
publicly accept that you won't be allowed to have what other adults are
allowed to have. That's humiliation for most people.
--
Les
Anyone regularly attending or organising protests should expect to be of
interest to the state.
Ste
> Alex Heney <m...@privacy.net> posted
>
> >It was his suggestion that it would be "humiliating" that I was
> >arguing against.
>
> I can easily see how one might feel humiliated, if one waa forced to
> walk away empty handed after being refused alcohol by a checkout girl.
> You've lost a public argument, you've had to admit defeat, you've got to
> publicly accept that you won't be allowed to have what other adults are
> allowed to have. That's humiliation for most people.
It may not be a question of outright "humiliation", but certainly of
anxiety and embarassment if one does not like the public show, and
certainly of irritation at not being able to purchase the goods that
you expected, and undoubtedly irritation at being disbelieved.
®i©ardo
The trouble is that you never know if it a "sting" or a "set up"/" by
the local trading standards in collaboration with the local constabulary
Engendered by the Licensing Act 2003, till staff and bar staff are at
risk of being heavily fined if they do get it wrong, hence they will err
on the side of caution, every time.
--
Moving things in still pictures
Alex Heney
Did you have nay point to posting that link?
Yes, that case was certainly humiliating, but is an *entirely*
different matter and different situation.
And I must admit, I am by no means convinced it *was* an innocent mix
up anyhow. It does seem rather an unlikely thing to happen, since the
card is normally swiped and handed straight back to you.
--
Alex Heney, Global Villager
Useless Invention: Caffeine-free Diet Coke.
Alex Heney
>On Sun, 12 Sep 2010 21:39:36 +0100, Alex Heney <m...@privacy.net>
>wrote:
>
>>On Sun, 12 Sep 2010 10:13:34 +0100, Gareth <m...@privacy.net> wrote:
>>
>>>
>>>On 12/09/2010 07:59, Paul Hyett wrote:
>>>> On Sat, 11 Sep 2010 at 12:04:29, Turk182 <digital...@aol.com> wrote
>>>> in uk.legal :
>>>>
>>>>> Two Sainsbury's customers were humiliated this afternoon, when at the
>>>>> branch where they usually get served without a hitch, today it was
>>>>> decided that both customers looked under 25 and so asked for proof of
>>>>> age.
>>>>
>>>> I don't understand why *25* anyway - you only need to be 18 to buy booze...
>>>
>>>To give some margin for error. It's very hard to judge age and a 17 year
>>>old could easily look a lot older than 18.
>>
>>Indeed.
>>
>>I remember my 12 year old daughter being take for 16+ when I went for
>>a meal once with her (plus my Wife and sister-in-law),
>
>Only because she was dressed like a 16+ year-old.
Why have you made that false assumption?
> 12-year-old girls
>wearing no make-up or tight jeans or low tops or any of the other
>paraphernalia that they all choose to make them look older, look like
>12-year-olds.
Was that sentence supposed to be in English?
>
>I recall an ITV programme similar to Lads' Army in which a group of
>15-year-olds were taken back to the 1950s and had to remove all their
>accoutrements of modern life, like piercings, make-up, and 'come on'
>apparel, and were then dressed as they would have been back then. The
>difference, especially in the case of the girls, was stark. Suddenly
>they looked like vulnerable children again -- and *they* were 15,
>not 12!
I am quite sure that many young people can and do dress in a way which
makes them look older (or in some cases younger) than their true age.
I can assure you this was not the case on the occasion I mentioned.
She was wearing the perfectly normal clothes she would usually wear
for a family outing.
--
Alex Heney, Global Villager
Building Contractors, not to be confused with homemakers
Turk182
I am just giving examples of Sainsbury and it's way of humiliating.
In the past, I told you about the automatic tills, which loudly shout,
"your card has been declined". I think at the time you said the
story was made up; but the truth was that it was happening to someone
almost every time I went in. It just appears that Sainsbury have
developed a lack of sensitivity for the dignity of their customers -
and the proof is in the detail of the stories emerging.
I still like the shop occasionally; though tend to see more respect
for customers in other chains.
Turk182
AndyW
"Turk182" <digital...@aol.com> wrote in message
news:efa2cf02-a30c-4a13...@c21g2000vba.googlegroups.com...
branch where they usually get served without a hitch, today it was
decided that both customers looked under 25 and so asked for proof of
age.
My son (14 years of age at the time) was refused a computer game because he
did not have proof of age. All very laudable, the supermarket is protecting
children except that this was a Wii Lego Star Wars game with a PEGI rating
of 3 years or more. Anyone who is not capable of noting the difference
between a 2 year old and a spotty, lanky teenager with his own bank card
need their eyes looking at.
Tesco have a strange attitude to alcohol. I have seen adult clearly over 18
asked for ID by an under 18 on the till who then shouted for a colleague to
oversee the transaction (collegaue behind did not even look, just said
"OK").
It clearly does not work both ways.
Andy
Turk182
>
> - Show quoted text -
I cannot find a definitive anser to the following question:
Is it an offence for an adult to purchase alcohol from a person who is
not of the required age to sell alcohol, or does not have an older
salesperson validating the sale?
The reason I want to know, is that if it IS an offence to do this,
then I can reasonably insist on seeing proof that the person selling
the alcohol is old enough to do so. I think that where prostitution
is concerned, it is not a defence in law to claim that you 'thought'
the lady was old enough - the same could be true if you purchase
alcohol from a minor.
You might even have an Over 25 policy of your own - in ehich case any
staff member looking 25 or younger should have to prove they are 18
and old enough to sell alcohol.
In any event, the procedures that different stores use to achieve the
sale, seems open to challenge in some cases.
http://uk.answers.yahoo.com/question/index?qid=20090313132012AA2Eg7a
Turk182
Alex Heney
No, it is not an offence.
It could maybe just about be argued that it could possibly be "aiding
and abetting" (their* offence of selling it without supervision from
the licensee.
But it certainly is not an offence in its own right.
--
Alex Heney, Global Villager
Close only counts in horseshoes and atom bombs.
Cynic
wrote:
>>I felt moved to write this today, because I am communicating the
>>degree of anxiety felt by the Sainsbury customers involved.
>No, you felt moved to write it because you are a poor oversensitive
>soul who is constantly "humiliated" by things which any normal person
>would see as a complete triviality.
>And most people who are over 25 would feel quite flattered to be
>thought under it, rather than feeling "humiliated" by it.
But not perhaps flattered enough to overcome the inconvenience of not
being able to buy the item they want.
I have been refused the sale of a pack of beer because I was
*accompanied* by a person who appeared to be under the age of 25, and
that made me pretty angry at the stupid policy - which in that case
has bugger-all to do with the law in any case.
--
Cynic
Cynic
<invalid...@invalid.com> wrote:
>The problem is that the retailers get punished very hard if caught selling
>to under eighteens.
Only if it can be proven that they knew, or ought to have known that
the person was under 18. If the person does not obviously look to be
under 18 to a reasonable person, the case would fail.
>If you look anywhere near 18 or under, you should carry some ID when buying
>alcohol. Retailers reserve the right to refuse to sell to anyone.
There is a problem in that it costs a fair bit of money to get the
sort of ID that is acceptable, and many young adults cannot afford to
do so.
--
Cynic
Cynic
>>> Two Sainsbury's customers were humiliated this afternoon, when at the
>>> branch where they usually get served without a hitch, today it was
>>> decided that both customers looked under 25 and so asked for proof of
>>> age.
>> I don't understand why *25* anyway - you only need to be 18 to buy booze...
>To give some margin for error. It's very hard to judge age and a 17 year
>old could easily look a lot older than 18.
In which case the store could not be convicted.
--
Cynic
Cynic
wrote:
>I remember my 12 year old daughter being take for 16+ when I went for
>a meal once with her (plus my Wife and sister-in-law), so she was
>asked if she was drinking wine as well when we ordered a bottle.
>If 12 can be mistake for 16, then I am sure there are 16-17 year olds
>out there who look like 20.
And why is it a problem if the occasional customer is under age? The
age limit is only a line in the sand in any case.
--
Cynic
Brimstone
"Mr. Benn" <invalid...@invalid.com> wrote in message
news:i6hvg6$kp6$1...@news.eternal-september.org...
Jethro
> On Sun, 12 Sep 2010 08:29:10 +0100, "Mr. Benn"
>
> >The problem is that the retailers get punished very hard if caught selling
> >to under eighteens.
>
> Only if it can be proven that they knew, or ought to have known that
> the person was under 18. If the person does not obviously look to be
> under 18 to a reasonable person, the case would fail.
IANAL, but didn't the law get changed so that it was an absolute
offence, thus removing any defence a retailer might have ?
Cynic
<krazy...@googlemail.com> wrote:
>> Only if it can be proven that they knew, or ought to have known that
>> the person was under 18. =A0If the person does not obviously look to be
>> under 18 to a reasonable person, the case would fail.
>IANAL, but didn't the law get changed so that it was an absolute
>offence, thus removing any defence a retailer might have ?
I don't think so BICBW.
If it were an absolute offence it would mean that a person could be
convicted even if they were shown an extremely convincing fake ID, so
no retailer would be safe.
--
Cynic
Jethro
> On Mon, 27 Sep 2010 07:53:09 -0700 (PDT), Jethro
>
> >> Only if it can be proven that they knew, or ought to have known that
> >> the person was under 18. =A0If the person does not obviously look to be
> >> under 18 to a reasonable person, the case would fail.
> >IANAL, but didn't the law get changed so that it was an absolute
> >offence, thus removing any defence a retailer might have ?
>
> I don't think so BICBW.
>
> If it were an absolute offence it would mean that a person could be
> convicted even if they were shown an extremely convincing fake ID, so
> no retailer would be safe.
Maybe a tame lawyer could settle this. ISTR this was one of the 2003
changes, and why so many retailers are going over the top with ID.
Remember NuLab was fond of absolute offences, as they effectively
bypassed juries, with their irritating insistence on common sense.
It was certainly the 2003 act which made it an offence for an *adult*
to purchase alcohol for someone under 18, although how this works in
practice, I have no idea. My son (very) occassionally will have a sip
of my wifes breezer. Does this mean I have broken the law by buying
the breezer ?
Alex Heney
Your question presupposes that it *is* a problem.
From the POV of the shops it is a "problem" only because they are
risking prosecution.
--
Alex Heney, Global Villager
Woman's mind is cleaner than man's; it changes more often
Alex Heney
No.
What the law (Licensing Act 2003) currently says is:
--------------------------------------
(4) Where a person is charged with an offence under this section by
reason of his own conduct it is a defence that—
(a) he believed that the individual was aged 18 or over, and
(b) either—
(i) he had taken all reasonable steps to establish the individual’s
age, or
(ii) nobody could reasonably have suspected from the individual’s
appearance that he was aged under 18.
(5) For the purposes of subsection (4), a person is treated as having
taken all reasonable steps to establish an individual’s age if—
(a) he asked the individual for evidence of his age, and
(b) the evidence would have convinced a reasonable person.
----------------------------------------
--
Alex Heney, Global Villager
Even worse than raining cats and dogs is hailing taxi's.
Alex Heney
They could, unless the appearance were such that "Nobody could
reasonably have suspected from the individual’s appearance that he was
aged under 18."
--
Alex Heney, Global Villager
Of all the things I've lost, I miss my mind the most.
Cynic
<krazy...@googlemail.com> wrote:
>Maybe a tame lawyer could settle this. ISTR this was one of the 2003
>changes, and why so many retailers are going over the top with ID.
>Remember NuLab was fond of absolute offences, as they effectively
>bypassed juries, with their irritating insistence on common sense.
>
>It was certainly the 2003 act which made it an offence for an *adult*
>to purchase alcohol for someone under 18, although how this works in
>practice, I have no idea. My son (very) occassionally will have a sip
>of my wifes breezer. Does this mean I have broken the law by buying
>the breezer ?
No. IIUC the term "buying on behalf of" means to take money from the
child and use it to buy the booze. Buying alcohol with your *own*
money is OK even if you intend to give the alcohol to a child.
Similar to the customs law, which allows you to bring back tobacco &
alcohol from other EU countries you visit, so long as it is for your
own use. "Own use" in that case includes *giving* it to other people,
but not selling it to other people or using their money to buy it in
the first place. You can legally bring back cases of booze for free
distribution at a wedding reception, for example, or buy many cartons
of ciggies to give to your wife upon your return (so long as she did
not give you the money to buy them).
But in any case, buying on behalf of a child would be an offence
committed by the adult being served, not the shop staff, so I do not
understand why supermarkets will not sell booze to an adult who is
merely accompanied by a child. After all, the fact that there is no
child physically with the adult does not mean that the adult is not
buying it on behalf of a child waiting outside the shop, so it is far
more likely to prevent legitimate sales than it is to prevent buying
on behalf of (which as I say, is nothing to do with the supermarket
anyway).
--
Cynic
Cynic
wrote:
>>>I remember my 12 year old daughter being take for 16+ when I went for
>>>a meal once with her (plus my Wife and sister-in-law), so she was
>>>asked if she was drinking wine as well when we ordered a bottle.
>>>If 12 can be mistake for 16, then I am sure there are 16-17 year olds
>>>out there who look like 20.
>>And why is it a problem if the occasional customer is under age? The
>>age limit is only a line in the sand in any case.
>Your question presupposes that it *is* a problem.
>From the POV of the shops it is a "problem" only because they are
>risking prosecution.
But if the child *looks* over 18, they are *not* risking a conviction.
--
Cynic
Cynic
wrote:
>>>>> Two Sainsbury's customers were humiliated this afternoon, when at the
>>>>> branch where they usually get served without a hitch, today it was
>>>>> decided that both customers looked under 25 and so asked for proof of
>>>>> age.
>>
>>>> I don't understand why *25* anyway - you only need to be 18 to buy booze...
>>
>>>To give some margin for error. It's very hard to judge age and a 17 year
>>>old could easily look a lot older than 18.
>>
>>In which case the store could not be convicted.
>
>They could, unless the appearance were such that "Nobody could
>reasonably have suspected from the individual’s appearance that he was
>aged under 18."
Which is the situation the PP stated when he said that a 17 year old
could look a lot older than 18 - if s/he *does* look a lot older (to a
reasonable person), the store has a valid defence, which was the point
I was making. No need therefore for all this "if you look under 25"
bull.
--
Cynic
S
The criterion is not "looking a lot older", but that "nobody could
reasonably have suspected from the individual’s
appearance that he was aged under 18". Sainsbury's and others decided
that the looking under 25 policy covers their backsides better than
the previous looking under 21 policy.
Alex Heney
Only if their appearance is such that no reasonable person could
suspect they were under 18.
--
Alex Heney, Global Villager
Hard work has a future payoff. Laziness pays off now.
Alex Heney
>On Mon, 27 Sep 2010 23:11:01 +0100, Alex Heney <m...@privacy.net>
>wrote:
>
>>>>>> Two Sainsbury's customers were humiliated this afternoon, when at the
>>>>>> branch where they usually get served without a hitch, today it was
>>>>>> decided that both customers looked under 25 and so asked for proof of
>>>>>> age.
>>>
>>>>> I don't understand why *25* anyway - you only need to be 18 to buy booze...
>>>
>>>>To give some margin for error. It's very hard to judge age and a 17 year
>>>>old could easily look a lot older than 18.
>>>
>>>In which case the store could not be convicted.
>>
>>They could, unless the appearance were such that "Nobody could
>>reasonably have suspected from the individual’s appearance that he was
>>aged under 18."
>
>Which is the situation the PP stated when he said that a 17 year old
>could look a lot older than 18 - if s/he *does* look a lot older (to a
>reasonable person), the store has a valid defence, which was the point
>I was making. No need therefore for all this "if you look under 25"
>bull.
No, it is NOT the same.
There are many people around who look like they are over 18 to a
reasonable person, but whose appearance is such that a reasonable
person could *suspect* they might not be.
There is also no guarantee that what the shopkeeper thinks they look
like is what the courts would decide a "reasonable person" might
think.
There is a lot more risk to the shops than you seem to think in just
going by what the shopkeeper/till operator thinks the person looks
like.
--
Alex Heney, Global Villager
Don't be so open-minded your brains fall out.
Cynic
wrote:
>On Tue, 28 Sep 2010 13:39:17 GMT, cyni...@yahoo.co.uk (Cynic) wrote:
>
>>On Mon, 27 Sep 2010 23:05:40 +0100, Alex Heney <m...@privacy.net>
>>wrote:
>>
>>>>>I remember my 12 year old daughter being take for 16+ when I went for
>>>>>a meal once with her (plus my Wife and sister-in-law), so she was
>>>>>asked if she was drinking wine as well when we ordered a bottle.
>>
>>>>>If 12 can be mistake for 16, then I am sure there are 16-17 year olds
>>>>>out there who look like 20.
>>
>>>>And why is it a problem if the occasional customer is under age? The
>>>>age limit is only a line in the sand in any case.
>>
>>>Your question presupposes that it *is* a problem.
>>
>>>From the POV of the shops it is a "problem" only because they are
>>>risking prosecution.
>>
>>But if the child *looks* over 18, they are *not* risking a conviction.
>
>Only if their appearance is such that no reasonable person could
>suspect they were under 18.
Which was the situation the PP stated and that I was responding to!
--
cynic
Alex Heney
No it wasn't.
There is a huge difference between "they look to be over 18" which is
what you and the OP have been saying and "no reasonable person could
suspect from their appearance that they might be under 18".
It is only a defence in law if the latter is true, the former is not
enough.
--
Alex Heney, Global Villager
I'm not dead. I'm electroencephelographically challenged.
Cynic
wrote:
>There is a huge difference between "they look to be over 18" which is
>what you and the OP have been saying and "no reasonable person could
>suspect from their appearance that they might be under 18".
>
>It is only a defence in law if the latter is true, the former is not
>enough.
I would say that if the former is true, the latter should not be found
to be false *BRD*.
There is a reason that the authorities use children who do *not*
appear to be over 18 when conducting their sting operations.
--
Cynic
Alex Heney
>On Wed, 29 Sep 2010 22:05:40 +0100, Alex Heney <m...@privacy.net>
>wrote:
>
>>There is a huge difference between "they look to be over 18" which is
>>what you and the OP have been saying and "no reasonable person could
>>suspect from their appearance that they might be under 18".
>>
>>It is only a defence in law if the latter is true, the former is not
>>enough.
>
>I would say that if the former is true, the latter should not be found
>to be false *BRD*.
>
Why emphasis the irrelevant bit?
You are confusing the requirement for proof of the offence (namely
selling alcohol to an under 18) which does have to be proved BRD, and
the requirement for a defence, where nothing has to be proved by the
prosecution.
The prosecution do not have to prove anything about the defence, it is
for the defence to prove (but only on balance of probabilities) that
no reasonable person could have suspected that the person was under
18..
>There is a reason that the authorities use children who do *not*
>appear to be over 18 when conducting their sting operations.
Yes, it makes things clearer by completely taking out any possibility
of that defence.
And it avoids accusations of entrapment.
--
Alex Heney, Global Villager
Those who can't write, write help files.
Charles Bryant
}On Mon, 27 Sep 2010 23:05:40 +0100, Alex Heney <m...@privacy.net>
}wrote:
}>From the POV of the shops it is a "problem" only because they are
}>risking prosecution.
}
}But if the child *looks* over 18, they are *not* risking a conviction.
Prosecution is not conviction. The licence holder might be afraid that
even unsuccessful prosecutions might result in loss of the licence,
possibly indirectly through adverse publicity leading to more
opposition to their licence.