'Bangers, which are explosives packed in a small tube, are banned from
sale in the UK under The Fireworks (Safety) Regulation 1997.'
We used to get empty pickle jars and drop them in and run like fuck.
Flying glass everywhere...
One of those that was great fun at the time, but in retrospect you
cringe at how lucky we were ;-)
We used to take the grips off our bike handlebars and shove bunches of lit
rockets in the tubes, then cycle like mad down a narrow street. Maybe I just
haven't kept up with inflation but I'm sure we used to buy absolute tons of
fireworks out of our pocket money. It seems like they're much more expensive
these days.
We used to find it much more fun to throw empty aerosol cans onto bonfires,
you had the added bonus of not knowing when it was going to go off... plenty
of variations on the "Russian roulette" game to be enjoyed :)
> We used to take the grips off our bike handlebars and shove bunches
> of lit rockets in the tubes, then cycle like mad down a narrow
> street. Maybe I just haven't kept up with inflation but I'm sure we
> used to buy absolute tons of fireworks out of our pocket money. It
> seems like they're much more expensive these days.
Heh, I remember doing that - with racing bars swivelled round into forward
pointing mortars... :o)
When I were a lad (around 1950), at Guy Fawkes, I amassed 10 shillings
worth of bangers (some 1d and some 2d), plus a shilling rocket. That was
quite a lot of money, in those days.
I used to do the following with bangers, and are highly recommended:
Wait until the fuze starts fizzing, and throw them into a pond or river.
Before exploding. they scud along the surface like a jet ski.
Weight them so they will sink (say, by poking them into a lump of wet
clay). Wait until the fuze starts fizzing, and throw them into a pond or
river. They explode on the bottom with a muffled thud, like a depth
charge.
Tape them to the stick of a rocket, banger fuze pointing upward, so that
the rocket exhaust flames ignites them. They explode high in the air
(and sometimes not so high!). Alternatively, you can launch the rocket
at your friends, 'bazooka-style', from a short length of scaffold tube.
If the rocket doesn't get them, the banger will.
Happy days!! It's sad that the kids of today will be denied the
opportunity to experiment and have so much (fairly innocent) fun.
--
Ian
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
Mike
--
Michael Swift We do not regard Englishmen as foreigners.
Kirkheaton We look on them only as rather mad Norwegians.
Yorkshire Halvard Lange
About that time my aunt used to make Vesuvius cases, the cone shaped
ones, at home for Standard Fireworks who's factory was a couple of miles
from where we lived, I well remember dozens of the things laid out in
front of the fire drying.
They later bought the newsagents shop next door and when they closed at
7pm brought all the unsold fireworks to out large bonfire just down the
road, Standard didn't do sale or return and fireworks were only set off
round November 5th., not year round as now.
To be fair the novelty soon wore off and everyone ended up just lighting
them one after another.
> One of those that was great fun at the time, but in retrospect you cringe
> at how lucky we were ;-)
Or were not as the case may be; a mate of mine lost three fingers when a
banger exploded in his grubby mitt.
John.
Lol. Me and my mates stopped shortly after we got to the point that
one of our home-made bombs cracked the paving stone on which it was
placed into pieces, and shot shards of twisted metal in all
directions. We expected it to be powerful, but I struggle to think of
the word to describe how we reacted - some mixture of thrill,
embarassment, and horror.
When my son was about 3 he spotted an Ali Baba laudry basket at John Lewis,
climbed in, and closed the lid on himself. He sat still for a minute, then
the basket started to move and he popped up smiling. Quite a surprise for
the fortunately middle-aged couple who had just come along.
--
Murphy's ultimate law is that if something that could go wrong doesn't,
it turns out that it would have been better if it had gone wrong.