> I have just had a renewal quote for my motor insurance which notes
> 'about claims & losses' - £TBC Accident Damage September 2010. Anyone
> know what £TBC stands for?
To Be Confirmed.
To Be Confirmed - Thanks Adrian - simple innit? :-)
OK when do you think that you will be able to confirm what TBC stands for?
Andy
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
Sorry Andy - I thought I was thanking you for your suggestion.
For some reason I hadn't picked up your 1st reply here in 'uk.legal' but via
Google, (and it still does not appear here for me), and so I couldn't do a
reply to your message here.
Or it may be that I am missing your humour :-) :-)
In any event - thank you (I think) for your help :-)
dfrog
You and me too Phister - but Insurance companies are nothing compared to the
training in this area that NHS people get.
I have an involvement (as a member of the public) with an NHS Foundation
Trust, and as an absolute layman in terms of clinical/medical knowledge, I
find clinical/medical issues far easier to understand that all the
abbreviations these very nice people use :-)
Thanks for your reply
dfrog
OOOPS
You're 'Andy' NOT 'Adrian' (who was the one who helped) Gulp :-)
And I spotted why I hadn't seen Adrian's reply here - he has a gmail address
which get filtered out for me :-)
dfrog
Lol, how risible!
I dread to think how long your Deoxyribonucleic Acid signature would
stretch, if we had to spell out Adenine Thymine Thymine...
When you can you confirm which abbreviation you want to know about?