Whats the law on laser pens over 1mW
Information
What is the law on laser pointers over 1mW
can these be sold with due diligence
For example can a 100 mW green laser pointer be sold and bought
as a consumer lawfully in UK or anywhere in EU , providing the item
has a CE certificate and due diligence is shown providing the purchaser
with safety information and how to use the item correctly
I read of some 100mW Blue lasers being available to public
steve robinson
The power of the laser is only part of the problem ,the human eye is
very sensitive to the light emitted at the wave length similar to
the one the green lasers emit at
Information
> I read of some 100mW Blue lasers being available to public
>
>
Correction , that should have been 1000mW Blue laser pointers
available to buy by general public , the health and safety seem to
recommend 1mW , so this blue laser is 1000 x recommended
safe power level for lasers
Phister
http://www.instructables.com/id/Blu-Ray-Laser-Phaser!/
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
Robin
Yes for some values of "consumer". But I suggest you spell out in
greater detail what you want to use it for in order to get a better
answer.
I have used >1mW but not one bought by Jack or Jill walking in off the
estate. There are indirect constraints: see the HPA safety sheet
http://www.hpa.org.uk/web/HPAweb&HPAwebStandard/HPAweb_C/1195733794576.
That includes:
"The HPA advises that the sale of laser products to the general public
for use as laser pointers should be restricted to Class 1 or Class 2
devices which should be classified in accordance with the requirements
of the current British Standard and should be sold with sufficient
accompanying information to enable the user to operate the product in a
safe manner. Toys should be Class 1 or of such low output that they do
not need to be classified.
After seeking advice from NRPB (now the Radiation Protection Division of
the HPA) the then Department of Trade and Industry urged Trading
Standards Authorities to use their existing powers under the General
Product Safety Regulations 2005 4 to remove laser pointers of a Class
higher than Class 2 (as defined in the British Standard) from the
general market. Such devices are too powerful for general use as laser
pointers and present an unacceptable risk in the hands of the consumer
because they may cause eye injury in normal reasonably foreseeable use.
[4] General Product Safety Regulations 2005, Statutory Instrument 2005
No. 1803, OPSI, London
( www.opsi.gov.uk/si/si2005/20051803.htm)."
My understanding is that most if not all have done so.
As for the other 26 Member States, there is a Usenet group francom .
justice,.........
--
Robin
PM may be sent to rbw0{at}hotmail{dot}com
Just zis Guy, you know?
I often wonder about the light from SFPs. We have a few that are not
blanked; I habitually blank them and deactivate those not configured
(mainly so that we have functional spares when they inevitably fail)
but I am almost alone in this within my group.
Guy
--
http://www.chapmancentral.co.uk/
The usenet price promise: all opinions offered in newsgroups are guaranteed
to be worth the price paid.
Information
>greater detail what you want to use it for in order to get a better
>answer.
I wish to understand what I can do to sell high power laser pens
and comply with the law
There seems to be plenty people selling them via internet in UK
are these people selling products that are illegal in Uk , or is it not
the case of the USE or abuse of them is illegal
http://www.spymodex.com/laser001.htm
http://www.pc-point.co.uk/electronic-gadgets/cool-gadgets/high-power-100mw-green-laser-pointer-all-metal-combat-edition
http://www.digitaldaffodil.co.uk/80mw-green-laser-pen-pointer-p-430.html?cPath=61&osCsid=562f0d48120860a2eab5f9351ac321d7
http://www.laserpointerdirect.co.uk/green-laser-gold-clip-p-202.html?zenid=0fc92c2a9f99486cccdaa6b5c42933d6
http://www.megagreen.co.uk/
http://www.technologyplanet.co.uk/50mw-kaleidoscopic-green-laser-stock-p-189.html
http://www.megalaseruk.com/laser01.htm
http://www.groovycart.co.uk/cart.php?c=405&p=19698
Mr. Benn
news:xn0gyb9q...@news.eternal-september.org...
But it's the power of the laser that dictates how much damage is caused to
the eye within the visible spectrum.
Robin
> i wish to sell lasers above 1mW , such as class 3 and 4
>
> I wish to understand what I can do to sell high power laser pens
> and comply with the law
In that case I suggest you take advice from your local trading standards
officers. And also perhaps check what insurance you will need and
whether a standard policy will cover the sale of such lasers.
> There seems to be plenty people selling them via internet in UK
> are these people selling products that are illegal in Uk , or is it
> not the case of the USE or abuse of them is illegal
Taking those 3 questions in reverse order:
a. use: it is certainly illegal to use some lasers in some ways. For
example, several people have been jailed for shining them at aircraft;
b. possession: I *think* the mere possession is not unlawful so long
as there is no criminal intent; but I could be wrong;
c. sale: I can't really add to what I said before about trading
standards.
As regards the sites you listed, I've not looked at all of them. But I
did see http://www.megagreen.co.uk/ states "WE have NO STOCK of any
laser over 1mW " and then invites you to go to a US site
http://www.wickedlasers.com/index.phpif you want one. It may be that
they have been dealt with by trading standards while other sites have
not. Trading standards can't check every business all the time. But
they will generally offer advice to businesses: you could just contact
the your council's and ask.
Oh, and you might want to take note of the experience of Wickedlasers
(http://www.sliceofscifi.com/2010/07/07/lucas-tries-to-stop-lightsaber-laser-sales/)
and not mention lightsabres if you want to avoid civil law issues with
George Lucas :)
Peter Parry
<in...@spamtrap.coooooom> wrote:
> i wish to sell lasers above 1mW , such as class 3 and 4
>
>I wish to understand what I can do to sell high power laser pens
>and comply with the law
If you intend to sell to a general audience - nothing, You can't sell
them to the public and comply with the law.
Section 5 of the General Product Safety Regulations 2005 says :-
5.—(1) No producer shall place a product on the market unless the
product is a safe product.
(2) No producer shall offer or agree to place a product on the market
or expose or possess a product for placing on the market unless the
product is a safe product.
(3) No producer shall offer or agree to supply a product or expose or
possess a product for supply unless the product is a safe product.
(4) No producer shall supply a product unless the product is a safe
product.
If you are importing them from outside the EU then, unless the
manufacturer has an EU based presence, you as importer are the
"producer" as far as this legislation is concerned..
Even if you are buying already imported items from an EU source you
are still a distributor (in the legislation the seller is a
distributor).and covered by Section 8 :-
"Obligations of distributors
8. — (1) A distributor shall act with due care in order to help ensure
compliance with the applicable safety requirements and in particular
he—
(a) shall not expose or possess for supply or offer or agree to
supply, or supply, a product to any person which he knows or should
have presumed, on the basis of the information in his possession and
as a professional, is a dangerous product;"
The Health Protection Agency has already stated that such devices are
dangerous products and "present an unacceptable risk in the hands of
the consumer because they may cause eye injury in normal reasonably
foreseeable use."
Your only defence would be to demonstrate the products were safe (an
impossible task as they are not) or that you were only supplying to
non-consumers. That would require rather more than the buyer
declaring they were a professional user. For example if on
examination of your records it showed that most goods were shipped to
private addresses and paid for in advance by PayPal or private credit
cards you would not have a defence of "professional supply only" no
matter how many tick boxes you put on your web site for customers to
declare they were industry users. If most of your supply was on
invoice to commercial addresses you would.
>There seems to be plenty people selling them via internet in UK
>are these people selling products that are illegal in Uk , or is it not
>the case of the USE or abuse of them is illegal
Supplying or possessing for supply the products to consumers is
illegal.
GB
>
>> There seems to be plenty people selling them via internet in UK
>> are these people selling products that are illegal in Uk , or is it
>> not the case of the USE or abuse of them is illegal
>
> Supplying or possessing for supply the products to consumers is
> illegal.
So, these items are not illegal to own in this country for personal use? But
selling them is illegal? I suppose there must be other examples, but I'm
struggling here to think of them.
--
Murphy's ultimate law is that if something that could go wrong doesn't,
it turns out that it would have been better if it had gone wrong.
Peter Parry
wrote:
>So, these items are not illegal to own in this country for personal use? But
>selling them is illegal? I suppose there must be other examples, but I'm
>struggling here to think of them.
There are quite a few.
Under the General Product Safety Regulations 2005 any number of items
could meet that description. Take the safety cover off an angle
grinder and it is remains perfectly legal to use - but not to sell.
Criminal Justice Act 1988
"141 Offensive weapons
(1) Any person who manufactures, sells or hires or offers for sale or
hire, exposes or has in his possession for the purpose of sale or
hire, or lends or gives to any other person, a weapon to which this
section applies shall be guilty of an offence and liable on summary
conviction to imprisonment for a term not exceeding six months or to a
fine not exceeding level 5 on the standard scale or both."
Possession of such a weapon at home is not an offence.
There are quite a few more. such as the Wireless Telegraphy Acts and
Telecommunications Act 1984. Selling alcohol to persons under 18 is
an offence, but possession of it by a person under 18 is not,
similarly cigarettes.
Robin
> So, these items are not illegal to own in this country for personal
> use? But selling them is illegal? I suppose there must be other
> examples, but I'm struggling here to think of them.
Wasn't there a recent example of rare birds eggs?
a...@b.invalid
>> use? But selling them is illegal? I suppose there must be other
>> examples, but I'm struggling here to think of them.
>
> Wasn't there a recent example of rare birds eggs?
In the case of eggs there's a possession offence.
a...@b.invalid
> dangerous products and "present an unacceptable risk in the hands of
> the consumer because they may cause eye injury in normal reasonably
> foreseeable use."
On that basis I would expect to see every car dealer and cookware
supplier in the country in the dock.
martin
Oh don't joke about it. The do-gooders here (Horsham) tried to get The
Cook Shop to remove all knives from public display and only have them
behind the counter and brought out if they were specifically asked for.
It apparently encourages knife crime to have cooking knives on display,
even if they do cost 50 quid for a paring knife. Strangely the 3 or 4
outdoor camping type stores were not targeted even though they sell
knives at 1/10 the price. I am not joking btw. Go figure (as they would
say in the US)
Stuart A. Bronstein
Like here:
http://media.comicvine.com/uploads/2/27722/998180-jiggs_14_medium.jpg
Robin
>
> In the case of eggs there's a possession offence.
Yes but AIUI it does not apply to eggs taken before 1954.
The case I had in mind was the auctioneer, Mr Railton, fined £1,000 in
March for listing an antique cabinet with old eggs. The reports at the
time stated that their *possession* was lawful because the eggs had been
taken before 1954 but their *sale* was not. The RSPB site supports
this:
"It has been illegal to take the eggs of most wild birds since the
Protection of Birds Act 1954 and it is illegal to possess or control any
wild birds' eggs taken since that time under the Wildlife and
Countryside Act 1981.
It is illegal to sell any wild bird's egg, irrespective of its age."
Hence the eggs Mr Railton had listed were returned to their owner (who
faced no charge).
Ian Jackson
does seem very unfair. Presumably it is to remove the need of the law
enforcers to have to prove that eggs being sold were taken after a
certain date.
I believe similar laws apply to ivory, which causes problems when trying
to sell - and certainly import or export - pianos.
--
Ian
A.Lee
> This sort of retrospective law (albeit only partially retrospective)
> does seem very unfair. Presumably it is to remove the need of the law
> enforcers to have to prove that eggs being sold were taken after a
> certain date.
>
> I believe similar laws apply to ivory, which causes problems when trying
> to sell - and certainly import or export - pianos.
There are many of these laws. One of the most disliked has been the
Handgun ban. Definitely a knee-jerk reaction from the Government of the
day - handgun crime has gone up many times over since they were banned,
yet the people who legally owned them before the ban never did get their
full value when they were banned. (The government set up a compensation
scheme, where you handed you gun in, it was valued, then they paid you
the value. In all cases I have heard of, the value was around 60% of its
true value before the ban.)
Now, as the Olympics are coming here, they will allow up to 300 shooters
from around the World into this Country with handguns, where handguns
are banned. The England team still have to go to mainland europe to
practice (apart from a very small number of individuals - less than 5
iirc)
Alan.
--
To reply by e-mail, change the ' + ' to 'plus'.
Roland Perry
2010, "a...@b.invalid" <a...@b.invalid> remarked:
And also the possession of collection equipment it seems:
http://www.bbc.co.uk/news/uk-england-nottinghamshire-11098838
A prolific egg collector from Nottingham has been convicted of
having equipment used to target birds' nests.
Aaron Kisiel, 39, from Hanley Avenue, Bramcote, had denied three
charges of possessing items capable of being used to take and
possess wild birds' eggs.
Magistrates heard RSPB officers seized a book on bird behaviour
and climbing equipment from his home in May 2009.
--
Roland Perry
GB
>
> And also the possession of collection equipment it seems:
>
> http://www.bbc.co.uk/news/uk-england-nottinghamshire-11098838
>
> A prolific egg collector from Nottingham has been convicted of
> having equipment used to target birds' nests.
>
> Aaron Kisiel, 39, from Hanley Avenue, Bramcote, had denied
> three charges of possessing items capable of being used to
> take and possess wild birds' eggs.
>
> Magistrates heard RSPB officers seized a book on bird behaviour
> and climbing equipment from his home in May 2009.
Do I have to hand in my ladder?
Adam Funk
> Oh don't joke about it. The do-gooders here (Horsham) tried to get The
> Cook Shop to remove all knives from public display and only have them
> behind the counter and brought out if they were specifically asked for.
Customer: I'm looking for a 15" chef's knife.
Shopkeeper: Shhh! [gestures towards the door at the back]
Customer tries to wander over nonchalantly and knocks on the door.
Chico opens a tiny door in the door.
Chico: What's the password?
Customer: Swordfish?
Stuart A. Bronstein
> Roland Perry wrote:
>>
>> And also the possession of collection equipment it seems:
>>
>> http://www.bbc.co.uk/news/uk-england-nottinghamshire-11098838
>>
>> A prolific egg collector from Nottingham has been
>> convicted of having equipment used to target birds'
>> nests.
>>
>> Aaron Kisiel, 39, from Hanley Avenue, Bramcote, had
>> denied three charges of possessing items capable of
>> being used to take and possess wild birds' eggs.
>>
>> Magistrates heard RSPB officers seized a book on bird
>> behaviour and climbing equipment from his home in May
>> 2009.
>
> Do I have to hand in my ladder?
Egg-zactly.