Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

Wheelchairs and heavy people...

686 views
Skip to first unread message

Jake

unread,
Mar 16, 2011, 5:05:02 PM3/16/11
to
I'm writing on behalf of someone who works in the area of supported living
for disabled users. The nature of the job is they provide care and living
support for these people, and often take them on short trips around town and
suchlike.

One such female user weighs 22 stone and thus is quite mobility impaired.
The wheelchair is operated by the staff member, and has power controls for
forwards and reverse, but not to steer. Steering is dependent on the staff
member applying a turning force similar to a hand powered wheelchair, (but
more analagous to steering a heavily loaded shopping trolley - as you will
see later) on the wheelchair, which has fixed rear drive wheels, but free
rotating front wheels.

Obviously this is fine on a billiard table flat surface, but on uneven
pavements and such like when the wheelchair loaded with 22 stone encounters
a dropped kerb, there is a tendency to pull the entire load down the slope
towards the roadway, instead of continuing straight on. Thus the staff
member who is female and probably weighing under 9 stone has to extert a
disproportionate amount of force to steer to prevent the wheelchair tipping
or ending up in the road, it really is difficult to control - similar to
trying to steer a heavily loaded shopping trolley along a pavement.

When the staff member raised concerns, other staff members also joined in
saying that they had problems, so the management organised a training
session for staff on correct use of the wheelchair. Of course this was
carried out in the level-as-a-billiard-table surface of their car park. You
will not notice much difficulty steering a laden trolley round a
supermarket, but take it on an uneven surface or even across a dropped kerb
and it is much more difficult to steer.

The staff member also pointed out that the test was flawed, not least
because the training supervisor had no trouble manoevering the wheelchair
because he was male, was probably able to exert greater strength, but the
test was carried out on a flat surface with a 9 stone person in the chair as
a load, and the disabled woman in question was 22 stone. The manager
declined the staff request for a demonstration of two people sitting in the
wheelchair - even though they would have fitted side by side as the woman
really is that large.

So the upshot of the event is that the manager has dismissed the concerns of
the staff as 'moaning troublemakers' - [verbatim quote]. He has also said
that he sees no need to make changes, and if people have problems with this,
they just won't be offered shifts in the future. So this will have
effectively silenced those who wish to hang onto their jobs in this
troubling economic climate.

I have been asked to see if there is anything that can be done about this,
so any advice is appreciated. Surely something in the manual handling
regulations?


Ian Smith

unread,
Mar 16, 2011, 6:30:19 PM3/16/11
to
On Wed, 16 Mar 2011 21:05:02 +0000, Jake <Ja...@jakesplaice.com> wrote:
>
> I have been asked to see if there is anything that can be done
> about this, so any advice is appreciated. Surely something in the
> manual handling regulations?

Possibly. I suggest you also ask in the discussion forums at
forum.iosh.co.uk (Institution of Occupational Safety and Health). You
need to register to post, but you don't need to be an institution
member to register. There's a reasonably active OSH forum with lots
of safety advisor types and at least some will know their manual
handling regs inside-out.

regards, Ian SMith
--
|\ /| no .sig
|o o|
|/ \|

Roger Merriman

unread,
Mar 17, 2011, 3:20:03 AM3/17/11
to
Jake <Ja...@jakesplaice.com> wrote:

realisticly in terms of kerbs and onto buses, either she stays in or she
will have heaved about, in terms of kerbs heavy or awkward wheelchairs
go down best in reverse, or you risk a runwaway train effect, any
wheelchair training should cover that.

manaul handling is that about handling someone not manovering a
wheelchair.

to be honest it seems to a rock and hardplace, even fully electric
chairs need help over kerbs and onto buses and so on. so either the lady
stays in or the staff cope.

what did the friend want in terms of laws?

Roger
--
www.rogermerriman.com

The Todal

unread,
Mar 17, 2011, 5:40:02 AM3/17/11
to

"Jake" <Ja...@jakesplaice.com> wrote in message
news:avmdnQfklORpuRzQ...@giganews.com...

Is the employer a private company or a local authority / NHS Trust? I would
guess private company because in my experience public bodies are very much
aware of their duties under the manual handling regulations. The employee
can raise a formal grievance with the employer, or speak to the Health and
Safety Executive (and maybe there would then be a visit from the HSE
inspector) and in the unlikely event that the employee was disciplined for
making trouble, there would be ample protection under unfair dismissal laws.

The risk of injury has to be kept to the lowest practicable level, and that
might involve carrying ramps around so that there is never a need to move
the wheelchair over a kerb, or getting specialist trainers in who deal with
the issue of changes in level (when the actual training took place, someone
ought to have spoken up and explained that they needed help with changes in
levels and with very heavy wheelchair users, rather than watch in silence -
if the trainer was asked, then maybe he didn't do his job properly and that
should be put on the "feedback forms" which ought to have been supplied).


Ian Smith

unread,
Mar 17, 2011, 6:45:02 AM3/17/11
to
On Thu, 17 Mar 2011 07:20:03 +0000, Roger Merriman <NE...@sarlet.com> wrote:
> Jake <Ja...@jakesplaice.com> wrote:
>
> > One such female user weighs 22 stone and thus is quite mobility impaired.
> > The wheelchair is operated by the staff member, and has power controls for
> > forwards and reverse, but not to steer. Steering is dependent on the staff
> > member applying a turning force similar to a hand powered wheelchair, (but
> > more analagous to steering a heavily loaded shopping trolley - as you will
> > see later) on the wheelchair, which has fixed rear drive wheels, but free
> > rotating front wheels.
>
> manaul handling is that about handling someone not manovering a
> wheelchair.

Not so - manual handling regs cover lifting and carrying yes, but also
pushing and pulling.

The HSE guidance in leaflet indg143 (see
www.hse.gov.uk/pubns/indg143.pdf) specifically talks about problems
relating to pushing and pulling, and in particular (relevant to this
case) the problems of slopes and uneven surfaces and that they must be
considered in the risk assessment. The same document specifies
guideline limits of force for pushing and pulling.

Walt

unread,
Mar 17, 2011, 3:10:01 PM3/17/11
to
"Jake" <Ja...@jakesplaice.com> wrote in
news:avmdnQfklORpuRzQ...@giganews.com:

This is not a case of moving the wheelchair (and occupant) over kerbs,
but a case of going along a pavement and crossing over a "drop kerb"
slope which will slope to the left or right of my direction of desired
travel.
I have spent many years in a wheelchair and regularly use a mobility
scooter. Whenever I cross a drop-kerb slope, the wheelchair/scooter
pulls severely towards the kerb (down the slope) and needs a certain
amount of force to correct this pull.
When being pushed in a wheelchair, I automatically drop my hands to the
wheels to assist the pusher to keep me level when crossing a drop kerb
slope. I have a lightweight wheelchair and weight only 10 stone (140
pounds).
The person mentioned by the OP is is serious danger of: (a) Losing
control of the chair and having it swing left or right down the slope -
this could cause the chair and patient to either run into the road or
tip over (wheelchairs are incredibly easy to tip over). (b) Causing
injury to the pusher by the twisting action necessary to keep the chair
on a straight course - this injury may become apparent immediately or
build up over a period of time to become a chronic injury.

The person concerned MUST inform her superiors - IN WRITING - that both
the patient and herself are are serious risk of injury. The employee
has a duty of care to her patient and herself. I fear that should the
patient be injured, the pusher could be considered at fault because she
KNEW she was unable to properly control the wheelchair. I also fear
that should the pusher injure herself (which is very likely, believe me)
then she will be held partly at fault by continuing with an action that
she knew was dangerous to herself.

I can only repeat, the employee MUST, MUST, MUST write to her employer
outlining the problem (mentioning the weight of the patient and chair,
the rough ground, the problems of crossing slopes). A copy of the
letter must be kept. I think that if a number of employees sign the
letter, it might have more effect.

Walt

(I am not a lawyer - just someone who exactly understands the problem
mentioned by the OP)

Jake

unread,
Mar 17, 2011, 5:15:02 PM3/17/11
to

"Walt" <wa...@walt.com> wrote in message
news:Xns9EABC2E16A...@216.196.109.145...

Thanks for this Walt, there was some debate about this particular effect
over on the unmoderated uk.legal.


Wm...

unread,
Mar 18, 2011, 1:20:02 AM3/18/11
to
Thu, 17 Mar 2011 19:10:01 <Xns9EABC2E16A...@216.196.109.145>
uk.legal.moderated Walt <wa...@walt.com>

>I have spent many years in a wheelchair and regularly use a mobility
>scooter. Whenever I cross a drop-kerb slope, the wheelchair/scooter
>pulls severely towards the kerb (down the slope) and needs a certain
>amount of force to correct this pull.
>When being pushed in a wheelchair, I automatically drop my hands to the
>wheels to assist the pusher to keep me level when crossing a drop kerb
>slope. I have a lightweight wheelchair and weight only 10 stone (140
>pounds).

It is good to have your input as a wheelchair user.

In your experience are hospital type wheelchairs where the wheels are
like this [-0-] suitable for outside use compared to (I am going to the
other extreme) sporting wheelchairs where the wheels are more like this
/-0-\ ?

Do you think the basic problem is that someone is trying to get away
with using an indoor chair (completely flat and smooth surfaces
presumed) outdoors where dropped curbs and such things are to be
expected?

apols for the ASCII art, I couldn't think of a better way of describing
what I meant without using a lot of words.

--
Wm...
Reply-To: address valid for at least 7 days

Geoff Berrow

unread,
Mar 18, 2011, 5:45:02 AM3/18/11
to
On Thu, 17 Mar 2011 19:10:01 +0000, Walt <wa...@walt.com> wrote:

>The person concerned MUST inform her superiors - IN WRITING - that both
>the patient and herself are are serious risk of injury. The employee
>has a duty of care to her patient and herself. I fear that should the
>patient be injured, the pusher could be considered at fault because she
>KNEW she was unable to properly control the wheelchair. I also fear
>that should the pusher injure herself (which is very likely, believe me)
>then she will be held partly at fault by continuing with an action that
>she knew was dangerous to herself.

Well AIUI the employee will always be responsible because of vicarious
liability.

It's the opposite end of the spectrum to my experience with the care
company that look after my mother.
--
Geoff Berrow (Put thecat out to email)
It's only Usenet, no one dies.
My opinions, not the committee's, mine.
Simple RFDs www.4theweb.co.uk/rfdmaker

The Todal

unread,
Mar 18, 2011, 8:50:03 AM3/18/11
to
Geoff Berrow wrote:
> On Thu, 17 Mar 2011 19:10:01 +0000, Walt <wa...@walt.com> wrote:
>
>> The person concerned MUST inform her superiors - IN WRITING - that
>> both the patient and herself are are serious risk of injury. The
>> employee has a duty of care to her patient and herself. I fear
>> that should the patient be injured, the pusher could be considered
>> at fault because she KNEW she was unable to properly control the
>> wheelchair. I also fear that should the pusher injure herself
>> (which is very likely, believe me) then she will be held partly at
>> fault by continuing with an action that she knew was dangerous to
>> herself.

No, if the pusher is using an unsafe system of work and has brought it to
the attention of management and is offered no better way of doing the job,
there should be no contributory negligence.

>
> Well AIUI the employee will always be responsible because of vicarious
> liability.
>

Vicarious liability makes the employer liable for the employee's negligence.

Walt

unread,
Mar 18, 2011, 10:10:02 AM3/18/11
to
"Wm..." <tcn...@blackhole.do-not-spam.me.uk> wrote in
news:LmXEfem1ougNFwtC@[127.0.0.1]:

> Thu, 17 Mar 2011 19:10:01 <Xns9EABC2E16AF00waltwaltcom@

Wheelchairs that have angled driving wheels are a different ballgame -
they are primarily designed for users use rather than for pushing.
They take a bit of getting used to and I personally don't like them.
Angled-wheel chairs seem to be able to move a lot faster with an
experienced user - me ? I'm too old for all that ! Heheheh

Walt

unread,
Mar 18, 2011, 10:15:02 AM3/18/11
to
"The Todal" <deadm...@beeb.net> wrote in
news:8uh2mm...@mid.individual.net:

The crucial words here are

"and has brought it to the attention of management and is offered no

better way of doing the job,".
That is why I was trying to persude the employee to report it in
writing.

Walt

Geoff Berrow

unread,
Mar 18, 2011, 10:35:02 AM3/18/11
to
On Fri, 18 Mar 2011 12:50:03 +0000, "The Todal" <deadm...@beeb.net>
wrote:

>> Well AIUI the employee will always be responsible because of vicarious
>> liability.
>>
>
>Vicarious liability makes the employer liable for the employee's negligence.

Wouldn't knowingly using a piece of unsafe equipment be negligent?

The Todal

unread,
Mar 18, 2011, 12:25:01 PM3/18/11
to
Geoff Berrow wrote:
> On Fri, 18 Mar 2011 12:50:03 +0000, "The Todal" <deadm...@beeb.net>
> wrote:
>
>>> Well AIUI the employee will always be responsible because of
>>> vicarious liability.
>>>
>>
>> Vicarious liability makes the employer liable for the employee's
>> negligence.
>
> Wouldn't knowingly using a piece of unsafe equipment be negligent?

That would depend on precisely what is meant by "unsafe" (eg a hammer with a
head that is so loose it is about to fall off, or a bike with severely worn
brakes, are straightforward defects that an employee should be aware of) and
also the nature of the training and experience of the employee who might not
necessarily understand the correct way of dong a job.


Just zis Guy, you know?

unread,
Mar 18, 2011, 12:40:02 PM3/18/11
to
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

The first and most obvious thing is to investigate whether a mobility
scooter would be a feasible replacement for trips out. These typically
handle bad surfaces much better than most wheelchairs, which are
primarily designed for indoor use.

I'd also contact the Disabled Living Foundation and see if they have any
advice and best practice.

Walt's comments make good sense: this should be placed on file in
writing not least because there is some possibility of injury leading to
a claim.

- --
Guy Chapman, http://www.chapmancentral.co.uk
The usenet price promise: all opinions are guaranteed
to be worth at least what you paid for them.
PGP public key at http://www.chapmancentral.co.uk/pgp-public.key
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v2.0.16 (MingW32)
Comment: Using GnuPG with Mozilla - http://enigmail.mozdev.org/

iQEcBAEBAgAGBQJNg4ohAAoJEJx9ogI8T+W/gkIH/1AMzB5sZRSf8Xe9i3ecteEz
fAW7a+I0GoaW03Oeyw+ywKFUndIq3e+x4Wr5fHsX4gzeSUiwFHrvotvmyPuWqK6z
6XZnzh2B3eX658lurD1sLy6qjkhNLBLWyHDhsp323aZhnwwjfPtWx7+9SGjRZSZN
c/ijyErSE8q69jdplAteTllfxTOgpJbyLYtVRduKH4f7RiMpvM87mQUShx8cpCXU
5rdUpJwrHEbP4n6PFKpV4EdKsXqvxY6qpwWPneVwE1SZijbsdiXnhXwWsM+SOZnR
T+ZTI/iiX664nmzWaQ2Fql3ldJeSBRt4HGJqWWepcKr5RLR6/8KcMj2DohDICvk=
=mBfW
-----END PGP SIGNATURE-----

Humbug

unread,
Mar 18, 2011, 4:10:02 PM3/18/11
to
On Fri, 18 Mar 2011 16:25:01 +0000, "The Todal" <deadm...@beeb.net>
wrote:

In the OP's description of the "training" it is evident that the
manager insists that there is no danger in a wheelchair being pushed
over any kind of terrain by any size of person with any weight of
passenger.

The vicarious responsibility is his alone, and I suspect that he might
find himself personally responsible for a large claim before very
long.

--
Humbug

Jake

unread,
Mar 18, 2011, 5:50:02 PM3/18/11
to

"Just zis Guy, you know?" <g...@chapmancentral.co.uk> wrote in message
news:im01n1$dde$1...@news.eternal-september.org...

The rider of the scooter does not have the [mental or physical] capacity to
control the wheelchair/scooter herself.


Geoff Berrow

unread,
Mar 19, 2011, 7:55:02 AM3/19/11
to
On Fri, 18 Mar 2011 20:10:02 +0000, Humbug <hum...@tofee.net> wrote:

>>>> Vicarious liability makes the employer liable for the employee's
>>>> negligence.
>>>
>>> Wouldn't knowingly using a piece of unsafe equipment be negligent?
>>
>>That would depend on precisely what is meant by "unsafe" (eg a hammer with a
>>head that is so loose it is about to fall off, or a bike with severely worn
>>brakes, are straightforward defects that an employee should be aware of) and
>>also the nature of the training and experience of the employee who might not
>>necessarily understand the correct way of dong a job.
>
>In the OP's description of the "training" it is evident that the
>manager insists that there is no danger in a wheelchair being pushed
>over any kind of terrain by any size of person with any weight of
>passenger.
>
>The vicarious responsibility is his alone, and I suspect that he might
>find himself personally responsible for a large claim before very
>long.

And /his/ employer?

roger merriman

unread,
Mar 24, 2011, 5:10:02 PM3/24/11
to
Ian Smith <i...@astounding.org.uk> wrote:

well yes all of my jobs have had manual handling, but within care manual
handling will normally be about lifting people.

Roger

roger merriman

unread,
Mar 24, 2011, 5:10:02 PM3/24/11
to
Jake <Ja...@jakesplaice.com> wrote:

how sure of that are you?

the reason i ask is people with really quite low capasity can and do use
eletric wheelchairs so if it hasn't been tried. you never know.

Roger

Phister

unread,
Mar 24, 2011, 7:20:02 PM3/24/11
to

I move a manual wheelchair around sometimes for my neighbour, I always have
to negotiate steep slopes and trip ridges by pulling the chair backwards,
because the caster type wheels on the front tend to go sideways.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


Clive George

unread,
Mar 24, 2011, 10:00:04 PM3/24/11
to
On 24/03/2011 23:20, Phister wrote:
> I move a manual wheelchair around sometimes for my neighbour, I always have
> to negotiate steep slopes and trip ridges by pulling the chair backwards,
> because the caster type wheels on the front tend to go sideways.

It's not instantly obvious how to handle a laden wheelchair. I had a few
rides in one last year (bust hip, and crutching more than a mile was
getting hard at points), and it was very obvious when the pusher knew
what they were doing, especially at kerbs. Surface irregularities, eg
tactile paving at crossings, were surprisingly tricky.


Species8472

unread,
Mar 25, 2011, 5:15:10 AM3/25/11
to
The key things are, of course, safety and consideration for the
occupants comfort and peace of mind.

I'm afraid that too many "carers" don't care and/or don't think. Even if
they do have the skills. Which many don't. After all, pushing a
wheelchair - any idiot can do it.

The courses, often available for free, are really good value.

I would think that if someone was injured whilst travelling in a
wheelchair controlled by another - legal and financial consequences
could easily result.

Or is it like first aid? IIUC, those rendering first aid without any
skill, training or sense generally escape the consequences.....


roger merriman

unread,
Mar 26, 2011, 8:00:03 AM3/26/11
to
Clive George <cl...@xxxx-x.fsnet.co.uk> wrote:

other thing is the wheelchair the cheap nasty things hospitals give out
are vile, but the better ones can be quite good, much better balanced
and able to cope with more surfaces.

Roger

roger merriman

unread,
Mar 26, 2011, 8:00:03 AM3/26/11
to
Phister <phi...@inbox.com> wrote:

> I move a manual wheelchair around sometimes for my neighbour, I always have
> to negotiate steep slopes and trip ridges by pulling the chair backwards,
> because the caster type wheels on the front tend to go sideways.

yes and because as the hill gets steeper it puts more load on the lower
back, on holiday in tenerife even with young lady who is light and i'm a
fairly strong man, you go down backwards where the risks are that much
less.

Roger

0 new messages