Pay for induction...
Jake
My friend has gotten work at a warehouse through an agency. First day there
he had to spend a few hours on induction, boring but necessary stuff like
how to lift, how to use a knife, how to use a pallet truck, fire safety,
exits, company policies, etc, and fill in loads of paperwork to show he'd
been through this training, which will be kept on file in case they need to
show they have provided him with the proper training, and can dig it out in
case of any possible incident to enable them to cover their arses.
Gets warehousing company to fill out timesheet for those hours and sends it
in, but doesn't get paid for it. On querying this, the agency tell him that
he doesn't get paid for this time, only time actually spent working.
A different group of people who did their induction immediately before
starting a shift (where they were being inducted whilst other staff were
working) were paid for the full day - induction and hours of actual work
worked.
Wages are above NMW. Any thoughts?
Yellow
Ja...@jakesplaice.com says...
Does sound fair but the true question is "How much does he want to
job?" and that isn't fair either. True though.
Owain
> Gets warehousing company to fill out timesheet for those hours and sends it
> in, but doesn't get paid for it. On querying this, the agency tell him that
> Wages are above NMW. Any thoughts?
Are the wages for the week still above NMW even after taking the
unpaid time into account?
Owain
sid
Any training I am expected to do through an agency I get paid the full
hourly rate for the job, even if the job starts weeks later.
I suspect this comes under the same rules as making an employee pay for
something that is the duty of the employer, like PPE. The time spent at
training is time away from home, where you are not free to dispose of
your time or do other work, so it should be paid for.
Ian Smith
> Suspect I already know the answer for this, but anyway...
>
> My friend has gotten work at a warehouse through an agency. First
> day there he had to spend a few hours on induction, boring but
> necessary stuff like how to lift, how to use a knife, how to use a
> pallet truck, fire safety, exits, company policies, etc, and fill
> in loads of paperwork to show he'd been through this training,
> which will be kept on file in case they need to show they have
> provided him with the proper training, and can dig it out in case
> of any possible incident to enable them to cover their arses.
>
> Gets warehousing company to fill out timesheet for those hours and
> sends it in, but doesn't get paid for it. On querying this, the
> agency tell him that he doesn't get paid for this time, only time
> actually spent working.
Training required for health and safety must be carried out in company
time and at company expense.
See http://www.hse.gov.uk/pubns/indg345.pdf page 4 - HSAW Act
mandates whatever induction is necessary to do the job safely, MHSW
Regs expand on it and highlight the need for training for new starts.
Training must be provided during working hours and not at the expense
of employee. You want regulation 13:
http://www.legislation.gov.uk/uksi/1999/3242/regulation13/made
"Every employer shall ... ensure that his employees are provided with
adequate health and safety training - (a) on their being recruited
into the employer's undertaking ... [the traing shall] take place
during working hours"
Self-employed for tax & NI purposes are generally treated as
employees for H&S purposes. Agency are probably likewise, but I don't
know the reg to quote - it might be covered by regulation 12.
The only get-out would be if the contract of employments says you get
paid x amount to complete the job and must work whatever hours are
necessary to do so. In that case, as long as doing the work + doing
the training is less time than minimum wage, they can probably argue
it's all part of the job. However, if it's agency work, it's probably
hourly paid and that doesn't apply.
regards, Ian SMith
--
|\ /| no .sig
|o o|
|/ \|
Jake
"sid" <bl...@blank.com> wrote in message
news:4d92865e$0$12165$fa0f...@news.zen.co.uk...
He has contacted the agency regarding this, and they replied along the lines
of
"If you insist on pursuing this, I will take it up with <Company>
management. However, by doing so, you will be exposing them to a
considerable extra cost. All of our other staff were happy that [the
induction] was unpaid. But if we pay one person for it, everyone will expect
it. Let me know what you want to do."
The potential threat is there, since the company can easily tell any of the
agency staff they are no longer required for any reason and without notice.
Ian Smith
>
> "sid" <bl...@blank.com> wrote in message
> news:4d92865e$0$12165$fa0f...@news.zen.co.uk...
> >
> > pay for something that is the duty of the employer, like PPE. The
> > time spent at training is time away from home, where you are not
> > free to dispose of your time or do other work, so it should be
> > paid for.
It is explicit in the management regs that necessary health and safety
training must be paid. It is preferably done within normal working
hours, but if that cannot be accommodated it must be in paid time and
free to teh employee (as for PPE, yes).
> He has contacted the agency regarding this, and they replied along
> the lines of
>
> "If you insist on pursuing this, I will take it up with <Company>
> management. However, by doing so, you will be exposing them to a
> considerable extra cost. All of our other staff were happy that
> [the induction] was unpaid. But if we pay one person for it,
> everyone will expect it. Let me know what you want to do."
Everyone should expect it already, what with it being the law.
Heaven forfend workers know their rights.
So - <Company> management don't want to comply with the law, on the
grounds of cost. It's cheaper to injure (or kill - I don't know what
you're doing) a few agency staff than pay for the legally mandated
training programme.
Find another job and then shop them to HSE? Some industries run
anonymous / confidential reporting processes, but there isn't a
blanket one covering all workplaces, so far as I know - if you make a
complaint / report to HSE you need to provide your full identifying
information. Not a terribly useful response, I admit.
Phister
You have no contract with the company........all business is conducted
through the agency, the people who should pay you for any training you
undertake.
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
NotMe
> Suspect I already know the answer for this, but anyway...
> Wages are above NMW. Any thoughts?
Check the contract, it may pay at NMW, but treat productive work as a
bonus. In this case they could regard the training and work as NMW,
but effectively pay higher that NMW to cover this.
I have seen contracts like this, worded something like "we will pay
you X per hour, but if you leave within the first week it will only be
NMW."
What others have said about perusing this, I would say if he wants or
expects to keep the job long term then write it off.
If he expects it to last a few weeks, or he gets fired after a few
weeks, complain then to the HSE, lodge a formal complaint after he
leaves, and sue for the money. Also keep a copy of the correspondence,
and how many hours were worked as training without pay.
Not the law, but sometimes it is best to be pragmatic.
Periander
$fa0f...@news.zen.co.uk:
>
> I suspect this comes under the same rules as making an employee pay for
> something that is the duty of the employer, like PPE.
I suspect that you're correct, I do know that it is unlawful for an
employer to make an employee pay for ppe, either first issue, maintainence
or replacement and I would striongly suspect (although I don't know as I
don't have the relevent Acts in front of me) that a safety induction very
much falls within the same catagory.
As others have pointed out though, how much does the person want the job
and the agency to find him other work in the future? It's not right, it's
not fair but you get my point.
--
Regards,
Periander
sid
I think agency work (even though I have done a lot of it) is a pretty
bad state of affairs, because it is used to bypass conforming with the
law so frequently and the agencies themselves are in such cut-throat
competition with each other they often 'accidentally' underpay. Every
time this has happened to me it is always a clerical error or some other
excuse, but every single agency except one has done it, and the amount
is *never* an overpayment but always underpayment.
It seems to be policy generally, among agencies, to rip people off.
Jake
"Ian Smith" <i...@astounding.org.uk> wrote in message
news:slrnip9hg...@acheron.astounding.org.uk...
I showed him this correspondence and it turns out they told him he needed
PPE too. The client company gave him a hi-vis and uniform, but on enquiring
about safety boots they said they didn't provide them. He asked the agency
and they said they wouldn't provide them either, but the most they would do
is lend him the money if he was short, to be deducted from his first wage
packet. So he bought them himself.
He does want the job, since he was on the dole previously, and it seems that
in a couple of months, the staff will move from the agency contract to being
employed by the company directly.
Consequently he doesn't want to be the one to rock the boat and force this
company into the additional expense of paying the agency to pay the staff
for the training, (about £60 worth of wages) since he considers it will
damage his chances of being offered a permanent contract when the agency
period is up.
I suspect the same is true of the other staff who wern't paid for this
training.
sid
If they won't pay for PPE they are totally open to him suing them if he
has an accident (say, loses a toe or three when a fork truck runs over
his foot). They absolutely MUST supply or pay for the PPE. It is this
fear of losing a job that is allowing agencies to drag employees back
decades in terms of their rights.
I have turned up for work before with my own boots and been told I must
take a new pair from them, because they do not know if mine are
approved. Ditto hard hats, they have an expiry date, a lot of places
insist you have a new hard hat, because if you have dropped yours, or
even put a sticker on it (the glue may affect the plastic apparently, as
can sunlight), it is not classed as safe.
I've worked in jobs for a year before via an agency and been told the
same "it will go permanent", it's nonsense usually, they just rotate you
out and other new people in, to avoid giving you a contract.
If they rip him off now and get away with it, they will carry on in any
dealings he has with them.
Humbug
The "agency" which I used to work through called itself a "diary
service", and were therefore able to avoid PAYE and employers' NI
contributions etc.
--
Humbug
sid
I have known them swap NI numbers around between people, when they
really wanted someone to work and the someone was officially disabled.
The whole lot needs very much reduced and (as is happening) equal rights
as much as possible for agency workers.
Other than the flexibility to say "I'm having the next 3 days off, then
working 2, then another 3 off" or whatever combination you like, there
is really no advantage to working for one. In most cases people don't
treat agency work this way they treat it as a step into a job, and
sometimes it does work out like that.
I have always liked agency work for the one reason that I can work when
I feel like it and stay at home when I feel like it, but I am lucky in
that there is a shortage of people doing what I do and a lot of work
about. Other than that even with the other advantage of being paid a
much higher hourly rate, it just isn't very good.
I recall one job where the agency was charging £18 per hour for me to be
there and I was getting £8.
tim....
"Humbug" <hum...@tofee.net> wrote in message
news:n0lcp6hfuivhofqnu...@4ax.com...
They might have thought that, but if the IR challenged it they wouldn't have
a leg to stand on
tim
Ian Smith
>
> I showed him this correspondence and it turns out they told him he needed
> PPE too. The client company gave him a hi-vis and uniform, but on enquiring
> about safety boots they said they didn't provide them. He asked the agency
> and they said they wouldn't provide them either, but the most they would do
> is lend him the money if he was short, to be deducted from his first wage
> packet. So he bought them himself.
If he were an employee, this would be completely illegal.
Training: MHSW Regs require that staff have a necessary safety
induction and mandate that it is in paid time:
http://www.legislation.gov.uk/uksi/1999/3242/regulation/13/made
Reg 13:
"(2) Every employer shall ensure that his employees are provided with
adequate health and safety training"
...
"3) The training referred to in paragraph (2) shall—
...
"(c)take place during working hours."
PPE: The PPE at Work Regs require PPE to be provided as free issue:
http://www.legislation.gov.uk/uksi/1992/2966/regulation/4/made
"Every employer shall ensure that suitable personal protective
equipment is provided to his employees "
However, if he is self-employed, it is more difficult. In the case of
the PPE, for example, he will have to provide the PPE to himself. In
theory, the fee he will have negotiated with the client will include
the sums necessary for him to meet his legal obligations to himself.
Whether an agency worker is an employee (of the agency or of the owner
of the site where working) turns out to be difficult to decide before
you get to the employment tribunal / courts. You're into the tests
along the lines of does he get to choose how to schedule or arrange
the work he has to complete, does he have to do the work personally
and so on.
Sounds like he's fallen into the grey area the Rita Donaghy was
concerned about in her report for the government ('One death is too
many' - you can find it on the web if you want, but it's possibly only
peripherally relevant). You'll be pleased to hear (I'm sure) that
industry assured the government it doesn't exist, and that there was
no need to extend the gangmasters licensing regulations.
> He does want the job, since he was on the dole previously, and it
> seems that in a couple of months, the staff will move from the
> agency contract to being employed by the company directly.
If they won't pay for legally mandated training, and won't provide
necessary PPE, I think the chances of this coming true are slightly
lower than that he wins the lottery and stops work entirely (even if
he doesn't buy a ticket). If it's actually construction (reference to
hi-vis, boots etc. suggests it might be, though it could equally be
(say) warehouse work) the chance is even lower, I'd say.