Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

Facial piercings on food premises....

465 views
Skip to first unread message

one_riff_brian

unread,
Apr 17, 2011, 5:40:03 PM4/17/11
to
...are they legal? The girl behind the counter of a pretty upmarket
chip shop had two. I'm squeamish about piercings to start with, but
allowing them in a food environment seems just crazy.

Steve Walker

unread,
Apr 17, 2011, 5:55:09 PM4/17/11
to

There's no obvious reason why they should be illegal, unless you have a
specific hazard in mind?


Wm...

unread,
Apr 18, 2011, 2:10:02 AM4/18/11
to
Sun, 17 Apr 2011 22:55:09 <9115oc...@mid.individual.net>
uk.legal.moderated Steve Walker <spam...@beeb.net>

I'm not a big fan of body art but can't see a facial piercing that has
been well done and has healed cleanly should be a barrier to someone
being employed.

As for the legality, I think if you are over 18 you can do pretty much
what you like to yourself, under 16 it is no, between 16 and 18 you need
parental permission. This came up in RL conversation recently as H
(just turned 16) wants to get a tattoo, mum says no.

From a societal POV we do seem to regard ear and perhaps nose piercing
differently to a big chunk of metal through an eyebrow or lip. I'm not
quite sure why that is. My guess is that we regard some piercing as
normal and others not normal, so it is our prejudices that should be
questioned really.

--
Wm...
Reply-To: address valid for at least 7 days

one_riff_brian

unread,
Apr 17, 2011, 6:50:02 PM4/17/11
to

I'd be worried about them falling out and into the food. I suppose I
should broaden it to any piercing jewellery.

Geoff Berrow

unread,
Apr 18, 2011, 4:35:05 AM4/18/11
to
On Mon, 18 Apr 2011 07:10:02 +0100, "Wm..."
<tcn...@blackhole.do-not-spam.me.uk> wrote:

> From a societal POV we do seem to regard ear and perhaps nose piercing
>differently to a big chunk of metal through an eyebrow or lip. I'm not
>quite sure why that is. My guess is that we regard some piercing as
>normal and others not normal, so it is our prejudices that should be
>questioned really.


I can deal with ear piercings - the rest make me cringe. But that's
just my problem.

Jewellery can fall off so I can see an argument for not allowing it in
food preparation areas.
--
Geoff Berrow (Put thecat out to email)
It's only Usenet, no one dies.
My opinions, not the committee's, mine.
Simple RFDs www.4theweb.co.uk/rfdmaker

Nightjar <"cpb"@

unread,
Apr 18, 2011, 3:20:03 AM4/18/11
to

There is a potential biological hazard from any exposed jewellery,
mainly because it rarely gets cleaned properly. This was a problem I ran
into when I operated a clean room for manufacturing medical devices.

Colin Bignell

Dave S.

unread,
Apr 18, 2011, 3:30:04 AM4/18/11
to
"Wm..." <tcn...@blackhole.do-not-spam.me.uk> wrote in message
news:C7IWoVchD9qNFwtm@[127.0.0.1]...

> Sun, 17 Apr 2011 22:55:09 <9115oc...@mid.individual.net>
> uk.legal.moderated Steve Walker <spam...@beeb.net>
>
>>one_riff_brian wrote:
>>> ...are they legal? The girl behind the counter of a pretty upmarket
>>> chip shop had two. I'm squeamish about piercings to start with, but
>>> allowing them in a food environment seems just crazy.
>>
>>There's no obvious reason why they should be illegal, unless you have a
>>specific hazard in mind?
>
> I'm not a big fan of body art but can't see a facial piercing that has
> been well done and has healed cleanly should be a barrier to someone being
> employed.
>
> As for the legality, I think if you are over 18 you can do pretty much
> what you like to yourself, under 16 it is no, between 16 and 18 you need
> parental permission. This came up in RL conversation recently as H (just
> turned 16) wants to get a tattoo, mum says no.
>


Not quite correct. There is no legal age of consent for body piercing, and
so it's legal for someone under the age of 18 to have a piercing as long as
they have consented to it. However children under the age of 16 can't
legally consent to a genital (or in the case of girls, nipple) piercing, as
it's considered to be indecent assault.

The Tattooing of Minors Act 1969 makes it illegal for anyone to tattoo you
if you are under the age of 18 - although the offence is with the person who
carries out the procedure, rather than the person who asks for the tattoo.

Dave S.

Wm...

unread,
Apr 18, 2011, 3:45:04 AM4/18/11
to
Sun, 17 Apr 2011 23:50:02
<a59e4d9a-3982-45f2...@p3g2000vbv.googlegroups.com>
uk.legal.moderated one_riff_brian <brianh...@googlemail.com>

I'm not sure I'm getting this. Would a man or woman with a pierced ear
fall foul of you or not? Would a woman with a nose piercing (part of
her culture) offend you too?

The legal circumstances are probably well covered by Health and Safety
regulation.

Speaking personally I'd rather have a healthy person with a whole lot of
face jewellery preparing my food than a person without anything stuck in
their face but with a runny nose.

As far as I can tell people that have decided to have body art don't
generally want the thing they have saved up for and spent money on to
fall into your food. Why do you think they'd want to give *you* their
bit of jewellery?

For the record I once wore earrings, I think the holes have closed up
now and I really can't be arsed to bother seeing if I can stick anything
into the holes again.

IanAl

unread,
Apr 18, 2011, 6:05:02 AM4/18/11
to

Clip on earrings &c. would be more likely to fall off than piercing
ones I would have thought.

I think you're just prejudiced against modern fashion.

Mark Goodge

unread,
Apr 18, 2011, 7:05:02 AM4/18/11
to
On Sun, 17 Apr 2011 22:40:03 +0100, one_riff_brian put finger to keyboard
and typed:

>...are they legal? The girl behind the counter of a pretty upmarket
>chip shop had two. I'm squeamish about piercings to start with, but
>allowing them in a food environment seems just crazy.

They are not illegal but they are discouraged in such circumstances. It's
one of the areas where, for example, employers are permitted to
discriminate against wearers without breaking the law. Most employers in
such circumstances would prohibit them; I'd be a little wary of one which
did not as it may well indicate a lax approach to hygiene in other areas of
their work.

http://www.google.co.uk/search?hl=en&q=food+hygiene+face+piercings returns
plenty of relevant links.

Mark
--
Blog: http://mark.goodge.co.uk
Stuff: http://www.good-stuff.co.uk

GB

unread,
Apr 18, 2011, 7:10:02 AM4/18/11
to
Geoff Berrow wrote:


> Jewellery can fall off so I can see an argument for not allowing it in
> food preparation areas.

Whilst I find the idea of mutilating one's body like this disgusting, I
think that jewellery fastened through piercings is far less likely to fall
off and contaminate the food than clipped-on jewellery.


--
Murphy's ultimate law is that if something that could go wrong doesn't,
it turns out that it would have been better if it had gone wrong.


Geoff Berrow

unread,
Apr 18, 2011, 8:45:02 AM4/18/11
to
On Mon, 18 Apr 2011 12:10:02 +0100, "GB" <NOTso...@microsoft.com>
wrote:

>Geoff Berrow wrote:
>
>
>> Jewellery can fall off so I can see an argument for not allowing it in
>> food preparation areas.
>
>Whilst I find the idea of mutilating one's body like this disgusting, I
>think that jewellery fastened through piercings is far less likely to fall
>off and contaminate the food than clipped-on jewellery.


I agree. I'd imagine jewellery of all descriptions should be removed
(or secured with sticking plaster perhaps) in food preparation areas.

Doesn't always happen though - we found a earring in a box of french
fries from a golden arched burger restaurant once.

one_riff_brian

unread,
Apr 18, 2011, 4:20:02 PM4/18/11
to
On Apr 17, 10:40 pm, one_riff_brian <brianhughe...@googlemail.com>
wrote:

> ...are they legal? The girl behind the counter of a pretty upmarket
> chip shop had two. I'm squeamish about piercings to start with, but
> allowing them in a food environment seems just crazy.

Thanks for all the replies. I spoke to the restaurant management this
morning, and it did sound like it's against their policies- she
promised to investigate. My common sense would say: if it's
detachable, then detach it, or secure it with blue sticking plaster-
what does culture or fashion have to do with it?

The two piercings in question were two of those horrible little "zits"
through her lips, one of which was flesh coloured. It didn't reassure
me one bit when I discovered that the outer bit, around the size of a
match head, is effectively a nut that screws onto a bolt through her
lip, and got thinking about the stripped threads on my Land Rover.

Dave S wrote:
> There is no legal age of consent for body piercing, and

>so it's legal for someone under the age of 18 to have a piercing as long as
> they have consented to it.
<snip>

Consented is fine, but have a look at this:

http://www.babyworld.co.uk/information/baby/health/pierce.asp

Sorry, that's beyond the pale.

Bernard Peek

unread,
Apr 18, 2011, 5:20:02 PM4/18/11
to
On 18/04/11 21:20, one_riff_brian wrote:
> On Apr 17, 10:40 pm, one_riff_brian <brianhughe...@googlemail.com>
> wrote:
>> ...are they legal? The girl behind the counter of a pretty upmarket
>> chip shop had two. I'm squeamish about piercings to start with, but
>> allowing them in a food environment seems just crazy.
>
> Thanks for all the replies. I spoke to the restaurant management this
> morning, and it did sound like it's against their policies- she
> promised to investigate. My common sense would say: if it's
> detachable, then detach it, or secure it with blue sticking plaster-
> what does culture or fashion have to do with it?

From the responses I've seen there doesn't seem to be any legal backing
for banning piercings - or at least nobody has yet cited any. Health &
safety law wouldn't cover this as there's nothing inherently unsafe. If
her manager doesn't handle this carefully he could find himself involved
in a tribunal case.

--
Bernard Peek
b...@shrdlu.com

Wm...

unread,
Apr 18, 2011, 6:40:02 PM4/18/11
to
Mon, 18 Apr 2011 21:20:02
<603f37c7-04b6-42da...@w7g2000pre.googlegroups.com>
uk.legal.moderated one_riff_brian <brianh...@googlemail.com>

>Consented is fine, but have a look at this:
>
>http://www.babyworld.co.uk/information/baby/health/pierce.asp
>
>Sorry, that's beyond the pale.

I'm disinclined to read further because the person that wrote the
article can't spell pierce correctly. If they can't be bothered to
proof read what they publish I'm not going to bother reading it.

Humbug

unread,
Apr 18, 2011, 6:55:02 PM4/18/11
to
On Mon, 18 Apr 2011 13:45:02 +0100, Geoff Berrow
<blth...@ckdog.co.uk> wrote:

>On Mon, 18 Apr 2011 12:10:02 +0100, "GB" <NOTso...@microsoft.com>
>wrote:
>
>>Geoff Berrow wrote:
>>
>>
>>> Jewellery can fall off so I can see an argument for not allowing it in
>>> food preparation areas.
>>
>>Whilst I find the idea of mutilating one's body like this disgusting, I
>>think that jewellery fastened through piercings is far less likely to fall
>>off and contaminate the food than clipped-on jewellery.
>
>
>I agree. I'd imagine jewellery of all descriptions should be removed
>(or secured with sticking plaster perhaps) in food preparation areas.
>
>Doesn't always happen though - we found a earring in a box of french
>fries from a golden arched burger restaurant once.

Are you sure it wasn't a promotional gift?

--
Humbug

Derek G.

unread,
Apr 18, 2011, 7:05:02 PM4/18/11
to
On Mon, 18 Apr 2011 22:20:02 +0100, Bernard Peek <b...@shrdlu.com>
wrote:

>From the responses I've seen there doesn't seem to be any legal backing
>for banning piercings - or at least nobody has yet cited any. Health &
>safety law wouldn't cover this as there's nothing inherently unsafe. If
>her manager doesn't handle this carefully he could find himself involved
>in a tribunal case.

Tiresome, but the employer would probably prefer that to winding up in
a criminal court because a contaminated batch of food product had
poisoned two or three hundred members of the public.

<http://www.eastriding.gov.uk/corp-docs/foodservices/Food_Focus/Food_Focus_Issue_1.pdf>

http://tinyurl.com/squits

All body piercings get infected sooner or later and few are kept
clean. There could be a constant temptation to adjust or fiddle with
it with the fingers especially if it got sore, at risk of
contaminating food with pus or purulent discharges.

For an employee to introduce any items into a food processing area the
employer has declared as forbidden would amount to Gross Misconduct.

Derek G

Nightjar <"cpb"@

unread,
Apr 18, 2011, 8:15:02 PM4/18/11
to
On 18/04/2011 22:20, Bernard Peek wrote:
> On 18/04/11 21:20, one_riff_brian wrote:
>> On Apr 17, 10:40 pm, one_riff_brian<brianhughe...@googlemail.com>
>> wrote:
>>> ...are they legal? The girl behind the counter of a pretty upmarket
>>> chip shop had two. I'm squeamish about piercings to start with, but
>>> allowing them in a food environment seems just crazy.
>>
>> Thanks for all the replies. I spoke to the restaurant management this
>> morning, and it did sound like it's against their policies- she
>> promised to investigate. My common sense would say: if it's
>> detachable, then detach it, or secure it with blue sticking plaster-
>> what does culture or fashion have to do with it?
>
> From the responses I've seen there doesn't seem to be any legal backing
> for banning piercings - or at least nobody has yet cited any. Health&
> safety law wouldn't cover this as there's nothing inherently unsafe.

I think it would be covered by Community Regulation 852/2004, which was
brought into UK law by the Food Safety Regulations 2006. However,
whether Environmental Health would bother to take issue with it, when
nobody seems to pull any food servery up on exposed hair, is another matter.

Colin Bignell

Geoff Berrow

unread,
Apr 19, 2011, 3:55:02 AM4/19/11
to
On Mon, 18 Apr 2011 23:55:02 +0100, Humbug <hum...@tofee.net> wrote:

>>Doesn't always happen though - we found a earring in a box of french
>>fries from a golden arched burger restaurant once.
>
>Are you sure it wasn't a promotional gift?

Well, we got a free meal out it. :-)

Bernard Peek

unread,
Apr 19, 2011, 4:15:02 AM4/19/11
to
On 19/04/11 00:05, Derek G. wrote:

> All body piercings get infected sooner or later and few are kept
> clean. There could be a constant temptation to adjust or fiddle with
> it with the fingers especially if it got sore, at risk of
> contaminating food with pus or purulent discharges.
>
> For an employee to introduce any items into a food processing area the
> employer has declared as forbidden would amount to Gross Misconduct.

Failure to obey a reasonable instruction would be a breach of contract.
But attempting to give an unreasonable instruction is also a breach. The
employer needs to make sure that they have the law on their side.

You say that all piercings get infected. Can you cite a journal
reference to that effect?


--
Bernard Peek
b...@shrdlu.com

Phister

unread,
Apr 19, 2011, 3:10:02 AM4/19/11
to

I have seen a couple of "recieves" this week as well.

--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT


Dave S.

unread,
Apr 19, 2011, 3:45:03 AM4/19/11
to
"Wm..." <tcn...@blackhole.do-not-spam.me.uk> wrote in message
news:iKMOkcB1xLrNFwCY@[127.0.0.1]...

If you're wanting to be so picky, then may I just point out that you should
have written "the person who wrote" rather than "the person that wrote".

Dave S.

Nightjar <"cpb"@

unread,
Apr 19, 2011, 4:30:03 AM4/19/11
to

If I still had the documentation from my days of running a clean room, I
could have given you a microbiologist's report on the contamination
hazards of *any* exposed jewellery. The main problem is that few people
clean jewellery well enough or often enough. I don't recall infection
being a major concern.

My staff were not happy about having to remove or to cover any
jewellery, but I had the microbiologist's report to show that it was a
reasonable instruction. I have no doubt that any food processing
business could also show that it was a reasonable instruction that was
necessary to comply with the Food Hygiene Regulations.

Colin Bignell

Wm...

unread,
Apr 19, 2011, 4:30:03 AM4/19/11
to
Tue, 19 Apr 2011 08:55:02 <jofqq6dcp10rbdl4e...@4ax.com>
uk.legal.moderated Geoff Berrow <blth...@ckdog.co.uk>

>On Mon, 18 Apr 2011 23:55:02 +0100, Humbug <hum...@tofee.net> wrote:
>
>>>Doesn't always happen though - we found a earring in a box of french
>>>fries from a golden arched burger restaurant once.
>>
>>Are you sure it wasn't a promotional gift?
>
>Well, we got a free meal out it. :-)


I think you are also the sort of person that would return the earring to
its owner.

Geoff Berrow

unread,
Apr 19, 2011, 7:35:02 AM4/19/11
to

If I could, yes [1]. We returned it to whence it came which was as
good as we could do. We know someone who works there and none of the
staff ever claimed it (or owned up to losing it).


[1] I'm always grateful to the person who found my car keys and
handed them into the police station. And sad that they never left an
address so I could thank them properly.

Wm...

unread,
Apr 19, 2011, 9:50:01 AM4/19/11
to
Tue, 19 Apr 2011 08:10:02 <xNednWr7267XqTDQ...@bt.com>
uk.legal.moderated Phister <phi...@inbox.com>

>I have seen a couple of "recieves" this week as well.

Pardon?

Wm...

unread,
Apr 19, 2011, 10:10:02 AM4/19/11
to
Tue, 19 Apr 2011 08:45:03 <ioje8r$4jb$1...@speranza.aioe.org>
uk.legal.moderated Dave S. <some...@overtherainbow.com>

My use of the third person has been argued about recently enough for me
to be confident in my use of it. I choose not to use "who" because I
don't know the person, the tense should be clear, they wrote it before I
read it.

This is uk.legal.moderated; babyworld isn't any sort of authority as far
as I can tell. It is just someone's opinion in support of their
argument.

Nightjar <"cpb"@

unread,
Apr 19, 2011, 2:00:03 PM4/19/11
to
On 19/04/2011 15:10, Wm... wrote:
> Tue, 19 Apr 2011 08:45:03 <ioje8r$4jb$1...@speranza.aioe.org>
> uk.legal.moderated Dave S. <some...@overtherainbow.com>
....

>> If you're wanting to be so picky, then may I just point out that you
>> should have written "the person who wrote" rather than "the person
>> that wrote".
>
> My use of the third person has been argued about recently enough for me
> to be confident in my use of it...

You may be confident about it, but the confidence is misplaced. 'That'
is an acceptable alternative to 'who' only after 'all', 'everyone',
'everybody', 'noone', 'nobody' or 'those'.

Colin Bignell

Nick Leverton

unread,
Apr 19, 2011, 3:55:02 PM4/19/11
to
In article <F78XoIM3DZrNFwk9@[127.0.0.1]>,

Wm... <tcn...@tarrcity.demon.co.uk> wrote:
>Tue, 19 Apr 2011 08:10:02 <xNednWr7267XqTDQ...@bt.com>
>uk.legal.moderated Phister <phi...@inbox.com>
>
>>I have seen a couple of "recieves" this week as well.
>
>Pardon?

A reference to a spilling problem in the subject line, I think, m'lud.

Nick
--
Serendipity: http://www.leverton.org/blosxom (last update 29th March 2010)
"The Internet, a sort of ersatz counterfeit of real life"
-- Janet Street-Porter, BBC2, 19th March 1996

Nick Leverton

unread,
Apr 19, 2011, 4:20:02 PM4/19/11
to
In article <iokp3o$nl7$1...@leverton.org>,

Nick Leverton <ni...@leverton.org> wrote:
>In article <F78XoIM3DZrNFwk9@[127.0.0.1]>,
>Wm... <tcn...@tarrcity.demon.co.uk> wrote:
>>Tue, 19 Apr 2011 08:10:02 <xNednWr7267XqTDQ...@bt.com>
>>uk.legal.moderated Phister <phi...@inbox.com>
>>
>>>I have seen a couple of "recieves" this week as well.
>>
>>Pardon?
>
>A reference to a spilling problem in the subject line, I think, m'lud.

Or even outwith the subject line. I shall return to my seat M'lud and
enjoy the claret in silence ...

Percy Picacity

unread,
Apr 22, 2011, 4:30:02 AM4/22/11
to
"Nightjar <\"cpb\"@" <"insertmysurnamehere>"@giganews.com> wrote in
news:1-mdnV2K_vpy2zDQ...@giganews.com:

> On 19/04/2011 09:15, Bernard Peek wrote:
>> On 19/04/11 00:05, Derek G. wrote:
>>
>>> All body piercings get infected sooner or later and few are kept
>>> clean. There could be a constant temptation to adjust or fiddle
>>> with it with the fingers especially if it got sore, at risk of
>>> contaminating food with pus or purulent discharges.
>>>
>>> For an employee to introduce any items into a food processing
>>> area the employer has declared as forbidden would amount to
>>> Gross Misconduct.
>>
>> Failure to obey a reasonable instruction would be a breach of
>> contract. But attempting to give an unreasonable instruction is
>> also a breach. The employer needs to make sure that they have the
>> law on their side.
>>
>> You say that all piercings get infected. Can you cite a journal
>> reference to that effect?
>
> If I still had the documentation from my days of running a clean
> room, I could have given you a microbiologist's report on the
> contamination hazards of *any* exposed jewellery. The main problem
> is that few people clean jewellery well enough or often enough. I
> don't recall infection being a major concern.

I am surprised by your microbioligist's report, unless he was
responding to a very narrow question. Exposed skin, and more
especially the mouth and nose and scalp, are "inevitably infected"
and produce a burden of skin debris and droplets probably thousands
of times higher than any single piercing could manage. Surely in a
clean room at least mouth, nose and hair would be covered, and in a
very clean room (e.g. semiconductor manufacture) no skin or outside
clothing at all would be exposed?


>
> My staff were not happy about having to remove or to cover any
> jewellery, but I had the microbiologist's report to show that it
> was a reasonable instruction. I have no doubt that any food
> processing business could also show that it was a reasonable
> instruction that was necessary to comply with the Food Hygiene
> Regulations.
>
> Colin Bignell
>

--
Percy Picacity

Nightjar <"cpb"@

unread,
Apr 22, 2011, 1:05:01 PM4/22/11
to

We were making medical devices, which were going to get very high doses
of radiation. There was no need to avoid particulate contamination and
biological contamination only need to be kept down to a level where
there was an acceptable probability that everything nasty would be
destroyed by the radiation. This was confirmed by weekly bioburden tests
on the rpoducts and work surfaces. The external auditor, for whom the
microbiologist worked, insisted that all hair and jewellery (not just
piercings) were covered at all times. Staff wore dedicated clean room
clothing and shoes, but face masks were not required.

Colin Bignell

Percy Picacity

unread,
Apr 24, 2011, 3:25:02 PM4/24/11
to
"Nightjar <\"cpb\"@" <"insertmysurnamehere>"@giganews.com> wrote in
news:SM-dneg30NGDKSzQ...@giganews.com:

That's interesting. I shall have to look up why jewellery (rather
than a piercing per se) is regarded as so hazardous.


--
Percy Picacity

0 new messages