What is the situation in a pub which does not have a clearly visible
price list, and I order a round of drinks and find myself unable to
pay, as I do not have enough money in my pocket? Am I stealing like at
a self-service petrol station if I do not have enough money?
Path: j33g2000vbb.googlegroups.com!not-for-mail
From: A UK Citizen <cjdro...@gmail.com>
Newsgroups: uk.legal.moderated
Subject: Pubs - Price List of Beers and Drinks
X-Posted-Date: Sat, 20 Nov 2010 04:45:26 -0800 (PST)
Date: Sat, 20 Nov 2010 12:50:02 +0000
Organization: http://groups.google.com
Message-ID: <9c5c4186-cd00-4e8c...@j33g2000vbb.googlegroups.com>
X-NNTP-Posting-Host: 188.28.154.180
MIME-Version: 1.0
Content-Type: text/plain; charset=ISO-8859-1
X-Original-Trace: posting.google.com 1290257127 5895 127.0.0.1 (20 Nov 2010 12:45:27 GMT)
User-Agent: G2/1.0
X-Ulm-Charter: http://www.usenet.org.uk/uk.legal.moderated.html
X-Ulm-Info-1: Submissions uk-legal-...@usenet.org.uk
X-Ulm-Info-2: Technical complaints only sysadmin (at) moderation.org.uk
X-Ulm-Info-3: Human moderators uk-legal-mode...@usenet.org.uk
X-Comment: The moderators express no opinion about this article.
X-Robomod: {R}UUM ©2003 Richard Ashton richard (at) moderation.org.uk
X-Robomod-Trace: 10385820101120212611TT manual
Approved: uk-legal-moderated moderators <uk-legal-...@moderation.org.uk>
I understood that it was the law of land for a pub clearly and visibly
to display a list of prices to its customers of its beers and other
drinks. Many pubs seems to be flouting this law. Please advise on the
current status of any regulations regarding this, as it thoroughly
annoys me everytime I enter a pub not to be able to calculate exactly
how much I going to be required to pay before ordering my drinks.
What is the situation in a pub which does not have a clearly visible
price list, and I order a round of drinks and find myself unable to
pay, as I do not have enough money in my pocket? Am I stealing like at
a self-service petrol station if I do not have enough money?
I am in total agreement with you. The law should be policed more
rigorously.
I always ask for the price of drinks outside the UK before I order.
Maybe I should do the same in the UK and maybe I should protest more?
Garages have to display their prices clearly. Why not pubs/bars or
indeed anywhere?
An old saying,; If you can't see the price, you can't afford it.
I've never seen one that doesn't display prices, even though that's usually
just a small A4 sign at the end of one bar.
I agree that they are very easy to miss in some places.
> Please advise on the
> current status of any regulations regarding this, as it thoroughly
> annoys me everytime I enter a pub not to be able to calculate exactly
> how much I going to be required to pay before ordering my drinks.
"How much is a pint of beer" works well in most pubs.
--
Alex
I don't think that I have ever been in a Pub that:
a) doesn't have such a list
b) doesn't try to hide it in the most hard to get to place.
You need to look harder
tim
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
For theft generally there has to be intent. If something is far more
expensive than could reasonably have been contemplated then simply not
having enough money available at the time would not be theft.
In many pubs signage is completely inadequate and abroad it is prudent
to ask if in doubt. Some places want return trade and others appear to
be happy to take an extortionate profit on the basis there will be a
different tourist along tomorrow.
>I don't think that I have ever been in a Pub that:
>a) doesn't have such a list
>b) doesn't try to hide it in the most hard to get to place.
The two pubs nearest me have their beer prices (and strengths) written
on large blackboards (in part because they are proud of the wide range
they stock) - I'd have to look next time to see where their remaining
prices were listed.
--
Roland Perry
>>I don't think that I have ever been in a Pub that: a) doesn't have such
>>a list
>>b) doesn't try to hide it in the most hard to get to place.
> The two pubs nearest me have their beer prices (and strengths) written
> on large blackboards (in part because they are proud of the wide range
> they stock) - I'd have to look next time to see where their remaining
> prices were listed.
There's usually a pricelist somewhere behind the bar - it's probably not
massively visible, but it'll be there.
If it is not cleary visible, you could just be awkward, ask the bar
staff for the price of every drink, then for the total price of
various combinations, 2 pints of this bitter, 1 pint of the other and
2 pints of that lager, etc,
--
Alex
The requirement is sumarised here. Lots of other similar items are disclosed
by Google.
Peter Crosland
> The two pubs nearest me have their beer prices (and strengths) written
> on large blackboards (in part because they are proud of the wide range
> they stock) - I'd have to look next time to see where their remaining
> prices were listed.
They probably are a 'real ale' pub?
One is (very much so, and good to have it so close), the other's a
fairly average suburbs pub.
--
Roland Perry
It's nice to visit a pub where the beers on offer are prominent, much in
the same way food is in a bistro.
Ideally beers should include price, strength and taste notes.
Ale boards around here tend to include strength and price but not so
often taste notes. Essex (but not the southern bit).
> >> There's usually a pricelist somewhere behind the bar - it's probably not
> >> massively visible, but it'll be there.
>
> > If it is not cleary visible, you could just be awkward, ask the bar
> > staff for the price of every drink, then for the total price of
> > various combinations, 2 pints of this bitter, 1 pint of the other and
> > 2 pints of that lager, etc,
>
> At which point they will tell you to leave.
>
> --
> Alex
I firmly questioned the bar maid in a pub once about the complete
absence of a properly displayed price list. She called the manager who
asked me somewhat forcibly to leave. What rights do I have in this
situation? Can I call a policeman?
Niceties aside, why is the law of the land being completely flouted?
Prices should be completely and clearly visible to the consumer in
this case.
You can, but they will tell you that you need to leave.
Landlords don't have to serve anyone they don't want to
--
Alex
>Niceties aside, why is the law of the land being completely flouted?
Because Trading Standards are under-funded.
--
Roland Perry
And there are more important things to worry about.
Lets face it, you can usually guesstimate the price of a pint of beer quite
well depending on the type of pub you visit and if you really need to know
in advance then it's easy to ask.
--
Alex
Or because no-one ever complains.
Trading Standards don't actively seek out transgressions of the law, at
least not in most cases. For the most part, they rely on complaints from
the public in order to discover cases which need investigation.
Mark
--
Blog: http://mark.goodge.co.uk
Stuff: http://www.good-stuff.co.uk
You can ensure you don't give them any business - if you go into a pub
and it doesn't supply what you want, go elsewhere and support one which
does.
IMO a pub is a place to go for a friendly drink and/or meal. Giving the
staff grief over a price list doesn't count as friendly. You're not
going to get anywhere but chucked out if you try and challenge the
situation, so there's no point in doing so.
If you feel really aggrieved about it it might be worth checking out
licensing laws - but don't combine business with pleasure. If you're out
for a drink, keep it that way, and save the complaining for another time.
I think this thread neatly illustrates the tension between the "buyer
beware" lobby and those who would introduce laws to make traders play
fair.
--
Roland Perry
But even when they get complaints, there's a threshold for
investigating.
--
Roland Perry
I just don't see it as something that needs to be any more of a legal matter
than it already is.
As has been established, pubs *do* display prices, they just don't make a
huge effort to have them visible, and asking is very simple.
--
Alex
> Trading Standards don't actively seek out transgressions of the law, at
> least not in most cases. For the most part, they rely on complaints from
> the public in order to discover cases which need investigation.
Strange that they find time to check petrol measures in a garage (I've
seen them), but never do the same for a pint of beer which costs more
per litre (never seen them)?
At which point you tell them that you will be reporting them to
Trading Standards for not displaying a clearly visible price list as
they are required to do.
Oh come on. Not everyone is affluent enough to not have to worry
about how much they are paying for things.
They are supposed to have a price list clearly visible so that you
know the price of things before you buy them - it could be part of
your choice.
Why on earth do you want to pick and chose what laws people obey?
How on earth can you "guesstimate" the price of a pint?
I know pubs where the price varies by as much as 50% from one pub to
another in a distance of a few hundred yards.
You could certainly not guess the price of a pint at any of them.
I have had a disagreement in a pub over a price - and then asked to
see the price list. The answer was : "It is usually up there" - I
told them not good enough - and they asked me to leave.
I didn't argue - I left - and the next day reported them to Trading
Standards. They were very interested and said that they would visit
the pub - and not only that - they would check the beer measures,
optics and other requirements for which they were responsible whilst
they were there.
> On 21 Nov, 16:40, "Dr Zoidberg" <AlexNOOOOO!!...@drzoidberg.co.uk>
> wrote:
>
> > >> There's usually a pricelist somewhere behind the bar - it's probably not
> > >> massively visible, but it'll be there.
> >
> > > If it is not cleary visible, you could just be awkward, ask the bar
> > > staff for the price of every drink, then for the total price of
> > > various combinations, 2 pints of this bitter, 1 pint of the other and
> > > 2 pints of that lager, etc,
> >
> > At which point they will tell you to leave.
> I firmly questioned the bar maid in a pub once about the complete
> absence of a properly displayed price list. She called the manager who
> asked me somewhat forcibly to leave. What rights do I have in this
> situation? Can I call a policeman?
The Landlord of a Pub is in quite a strong position in his pub.
He can eject whoever he likes, and give them no reason for their
ejection.
If you report it to the Police, they will undoubtedly back the Landlord
as he is quite in his rights to throw out anyone.
The only time the Police will become involved is if the Landlord has
ejected someone because of a discrimination - such as not liking
non-english etc, or more usually, based on skin colour.
If he does not like Welsh or Scots, he can quite legally eject them, so
long as he gives them no reason for their ejection.
As to the price list query, it is a minor matter. If reported to Trading
Standards, all that TS will do is advise the Landlord that a price list
must be displayed. Only after 2 or 3 times of not displaying, will
action be taken.
Even then, it is a very minor offence, and I doubt if there have been
more than 5 prosecutions for such a thing in the last 10 years, if any.
I think it is the Local Councils who uphold Licensing Laws now.
This query came up 2 weeks ago at a pub that had been re-opened. The
Landlady was not at all bothered that a price list was not displayed.
Alan.
--
To reply by e-mail, change the ' + ' to 'plus'.
The pubs I like generally have a proudly displayed blackboard like
that, at least for the real ales. But I've seen a lot of (less
interesting, IMHO) pubs with an A4 sheet in some awkward position so
it's unreadable without a lot of "excuse me" manoeuvring to get
close.
>On 22/11/2010 13:40, Mark Goodge wrote:
That's because it's relatively easy for the customer to tell if they're
getting short measures in the pub (assuming that the glasses are
legitimately crown marked - and I'm not aware of fakes being an issue), and
as the fill process is manual there's nothing to go wrong mechanically. By
contrast, a petrol station customer has no way of verifying that the pump
really is dispensing the amount it says it is, and since it's all
electro-mechanically controlled it's possible for something to go wrong
without requiring any malice or incompetance on the part of the staff.
Ah, you've never seen metered beer or optic spirits. Although the
original issues was price, not quantity.
--
Roland Perry
The "already is" requires a price list t be displayed.
>As has been established, pubs *do* display prices, they just don't make
>a huge effort to have them visible, and asking is very simple.
Unfortunately, some don't. And others put it somewhere very hard to
find.
--
Roland Perry
But lots of the available commentary is recently outdated:
"The legislation that applies to the display of prices in pubs, cafes and
restaurants is now the Consumer Protection from Unfair TradingRegulations
2008 (the CPRs). The Price Marking (Food and Drink Services) Order 2003
was repealed by the CPRs, and so no longer applies...."
http://webcache.googleusercontent.com/search?q=cache:YW02iLiJwAoJ:www.lacors.gov.uk/lacors/upload/23979.doc
CPRs: SI 2008/1277 http://www.legislation.gov.uk/uksi/2008/1277/contents/made
The measures provisions are now in the Licensing Act 2003 (Mandatory Licensing
Conditions) Order 2010, SI 2010/860.
http://www.legislation.gov.uk/uksi/2010/860/contents/made
--
Iain Archer To email, please use Reply-To address
And then (in the unlikely event they actually don't have one
displayed) they will just make sure that by the time the TS inspector
arrives, they have one.
"You" will still have been ejected, and will be unlikely to be allowed
back.
--
Alex Heney, Global Villager
A bird in the hand can be messy.
To reply by email, my address is alexATheneyDOTplusDOTcom
In the unlikely event it is, you would have to ask the landlord that
question.
You are unlikely to get a rational answer though.
>Prices should be completely and clearly visible to the consumer in
>this case.
They probably are, you just didn't see them.
I have yet to visit any pub where I have looked and been unable to
easily find the price list.
--
Alex Heney, Global Villager
I tried being reasonable once. I didn't like it.
>On Mon, 22 Nov 2010 14:10:02 +0000, "Dr Zoidberg"
><AlexNOOOOO!!!!!@drzoidberg.co.uk> wrote:
>
>>
>>"Roland Perry" <rol...@perry.co.uk> wrote in message
>>news:MTO4wKD6...@perry.co.uk...
>>> In message
>>> <f11acb67-ecf5-4800...@k30g2000vbn.googlegroups.com>, at
>>> 11:20:02 on Mon, 22 Nov 2010, A UK Citizen <cjdro...@gmail.com>
>>> remarked:
>>>
>>>>Niceties aside, why is the law of the land being completely flouted?
>>>
>>> Because Trading Standards are under-funded.
>>
>>And there are more important things to worry about.
>>Lets face it, you can usually guesstimate the price of a pint of beer quite
>>well depending on the type of pub you visit and if you really need to know
>>in advance then it's easy to ask.
>
>
>
>Oh come on. Not everyone is affluent enough to not have to worry
>about how much they are paying for things.
>
Nor has anybody suggested that might be the case. I don't understand
where that comment came form at all, since it does not appear to
relate to what you are responding to in any way.
>They are supposed to have a price list clearly visible so that you
>know the price of things before you buy them - it could be part of
>your choice.
>
Absolutely.
>Why on earth do you want to pick and chose what laws people obey?
>
Where is there any indication that he might want any such thing?
>How on earth can you "guesstimate" the price of a pint?
>
Very easily.
I don't go in to pubs all that often, but even so, I can be reasonably
sure to within a few pence of how much a particular common beer is
likely to be in any given pub in my own locality. Obviously any
"specials" are likely to be harder to guess, but then I have never
seen those without prices, and if you don't now the general level of
prices in an area, you are going to find it harder to guess for a
particular establishment (having no baseline).
People who use pubs more frequently would find it easier than I do.
>I know pubs where the price varies by as much as 50% from one pub to
>another in a distance of a few hundred yards.
>
That is not uncommon.
>You could certainly not guess the price of a pint at any of them.
That is uncommon, IME.
>
>I have had a disagreement in a pub over a price - and then asked to
>see the price list. The answer was : "It is usually up there" - I
>told them not good enough - and they asked me to leave.
>
>I didn't argue - I left - and the next day reported them to Trading
>Standards. They were very interested and said that they would visit
>the pub - and not only that - they would check the beer measures,
>optics and other requirements for which they were responsible whilst
>they were there.
If it was genuinely "usually up there", then I expect it was back up
well before TS arrived. If he was lying, then maybe it wasn't.
--
Alex Heney, Global Villager
Help Wanted: Telepath. You know where to apply.
Indeed.
If it's a Wetherspoons it's going to be at the low end. If it's a posh
independent pub that does high quality food it will be at the other end of
the scale.
There's nothing too difficult about working out where a pub fits in.
--
Alex
In bars where the staff free-pour spirits they are regularly tested to
check they're doing it right.
>> Ah, you've never seen metered beer or optic spirits. Although the
>> original issues was price, not quantity.
>
>In bars where the staff free-pour spirits they are regularly tested to
>check they're doing it right.
I've never understood on what basis some bars make cocktails - pouring
the spirits in entirely freehand.
However, getting back to prices, the issue there isn't so much the cost
of a pint (because local market forces will tend to self-regulate that)
but what they charge for the more exotic stuff.
--
Roland Perry
> Strange that they find time to check petrol measures in a garage (I've
> seen them), but never do the same for a pint of beer which costs more
> per litre (never seen them)?
A barmaid I knew many years ago said they could tell weights and measures
(now TS) a mile off when they entered the premises.
Several years later I was (as was common at the time) having lunch in a pub
when someone arrived and ordered two pints. I was (don't know specifically
why) alerted to him not being a customer. He asked to see the licensee (to
witness the check) just as his accomplice was arriving with his measuring
cylinder behind his back.
As it hapened they /were/ TS, and the pub provided adequate measure. My pint,
served prevously, was also up to standard.
It was obvious to me they weren't normal punters.
--
BD
Change lycos to yahoo to reply
Trading Standards, a wing of Local Government, poorly staffed,
refusing to implement severely the law with regard to price display
that's a grave shame. It's grossly unfair to the public. That same
Local Authority will probably implement parking regulations
ruthlessly. How come it chooses to implement one set of regulations in
a well staffed manner and weakly ignore others?
The public and citizens' rights count for nothing much in this
country.
> I understood that it was the law of land for a pub clearly and visibly
> to display a list of prices to its customers of its beers and other
> drinks. ...
You understood correctly (and for the benefit of all who have speculated
on the question) I believe that the answer is given in the:
Price Marking (Food and Drink on Premises) Order 1979 brought about by
section 2(6) of the Prices Act 1974. (There's been so many orders I may
be wrong on the date)
And if anyone is interested Giles did a very good cartoon on the subject
when it came in to force - which is why it stuck in my mind.
The scene ... old man in rural pub (three appropriately dressed men
stood behind him - two in whigs and gowns and all looking very stern),
old fashioned bar with a 16 stone sour faced landlady ...
The caption ...
"Now this is my council, my junior council and my solicitor, lets see
you short change me now you old trout." (I may be a word or two out,
it's been many years since I last saw it)
--
Regards,
Periander
> I just don't see it as something that needs to be any more of a legal matter
> than it already is.
> As has been established, pubs *do* display prices, they just don't make a
> huge effort to have them visible, and asking is very simple.
No such generalised truth has been established at all.
In my area the vast majority of pubs do NOT put up the prices of the
regular and ordinary bitters that most of the customers want to drink
They do display the prices of PIMMS, cocktails, luxury wines, mulled
wines.
Some of them, if they do post a price list make no effort whatsoever
to make it easily visible from the bar where one goes to buy that
beer.
>I understood that it was the law of land for a pub clearly and visibly
>to display a list of prices to its customers of its beers and other
>drinks. Many pubs seems to be flouting this law. Please advise on the
>current status of any regulations regarding this, as it thoroughly
>annoys me everytime I enter a pub not to be able to calculate exactly
>how much I going to be required to pay before ordering my drinks.
Are we talking about you ordering a pint and being asked for GBP15 or
are we talking about a few pennies difference to what you expected?
I'm on the side of folks that sort of know how much a pint is going to
cost before ordering and expect to have enough money in my pocket at the
time that I place my order.
Mind you, the last time I ordered a pint was at the RFH bar and one of
the little plastic legs had broken off the price display so it was
balanced against some plastics (or should we still continue to call them
glasses?) The lady that pulled my pint was happy to serve me and my
friend but wasn't happy about the price display getting in her way
because each time she picked up a plastic to serve someone the price
display board fell over.
Perhaps I should go to pubs more often.
>What is the situation in a pub which does not have a clearly visible
>price list, and I order a round of drinks and find myself unable to
>pay, as I do not have enough money in my pocket? Am I stealing like at
>a self-service petrol station if I do not have enough money?
I would not expect to visit my local pub without being able to pay for
what I had ordered. At the risk of repeating myself are we talking
about pennies or pounds here?
--
Wm...
Reply-To: address valid for at least 7 days
I don't believe you have been to many pubs in London, say, where the
name of the game is rip the consumer off wherever possible, even by
flouting the law. Most pubs in my area refuse to display their drinks
prices clearly and comprehensively. Most put up large blackboard
advertising the price of expensive yuppy drinks like "Pimms" or Wine,
or cocktails, but not of regular and normal beers.
It is clear they are trying to kill of the standard business of a pub.
>>How on earth can you "guesstimate" the price of a pint?
>>
>
>Very easily.
Oh really - please explain.
I go out for lunch to a village I have not been to for say a year.
I go in to a pub - there is no price list.
How do I "geusstimate" the price of the different beers on offer.
Do you guesstimate all prices of items if they are not on display in
shops?
I can assure you that we go to pubs where the prices of draught beers
can vary from 1.50 up to 3.50 per pint.
There is no way to "guesstimate" what the price may be.
> Obviously any
>"specials" are likely to be harder to guess, but then I have never
>seen those without prices, and if you don't now the general level of
>prices in an area, you are going to find it harder to guess for a
>particular establishment (having no baseline).
>
>People who use pubs more frequently would find it easier than I do.
>
>
>>I know pubs where the price varies by as much as 50% from one pub to
>>another in a distance of a few hundred yards.
>>
>
>That is not uncommon.
I am unsure how you will know that when you do not go in to pubs all
that often?
If we go to a pub for lunch (as we do often) - I want to know what
different sorts of drinks are on offer and how much they are.
That is quite a simple concept.
I certainly disagree "within a few pence"?
Unless one pound fifty in three pounds twenty is a few pence.
Do you think it is ok for the pub to not display the price and "get
away" with it?
You seem to be coming from that point of view.
Two points.
1. If I fail to ask for the price of a pint before ordering it and the
barman charges me £15, can I refuse to pay?
2. A customer who is short measured by 10mm on a £3 pint is robbed of
26.4 pence. How do they get away with it?
<snip>
>They probably are, you just didn't see them.
How on earth can you say that?
>I have yet to visit any pub where I have looked and been unable to
>easily find the price list.
You have already told us that you do not go in to pubs very often - so
you won't have checked very many.
Why, as a matter of interest, were you looking for the price list,
surely you could "guesstimate" the prices :-)
I'm pretty sure I could tell you where a pint of Stella is going to fit in
the £2-4 range, probably to within twenty pence.
It's very easy to tell if it's a cheap pub or not.
>
> Do you think it is ok for the pub to not display the price and "get
> away" with it?
>
> You seem to be coming from that point of view.
I have yet to see a pub where the printed price list isn't on display
somewhere. It's not something that they make a big show of, but it will be
there.
That and asking the price is perfectly sufficient for the vast majority of
the population.
--
Alex
This is a re-post.
Three points.
1. If I order a pint without asking for the price beforehand and charged
£15, can I refuse to pay?
2. If a customer is short measured by 10mm on a standard pint glass
which costs £3 a pint, in monetary terms it amounts to 26.4 pence.
3. Some customers who order port for instance, are often given a spirit
measure when it should be a fortified wine measure.
> Trading Standards, a wing of Local Government, poorly staffed,
> refusing to implement severely the law with regard to price
> display that's a grave shame. It's grossly unfair to the public.
> That same Local Authority will probably implement parking
> regulations ruthlessly. How come it chooses to implement one set
> of regulations in a well staffed manner and weakly ignore
> others?
How much money do they make for citing a pub for not posting prices?
My guess is that parking violations are a lot more profitable for
them.
Of course there is.
A combination of the quality of the pub buildings and interior , experience
of previous drinks and whether you are asking for cheap mass-produced lager
like Fosters or something more exclusive like Staropramen will do the job.
And then, you could always consider looking for the price list or speaking
politely to the staff.....
--
Alex
Yes, and the pub could then attempt to sue you for the cost of the "wasted"
drink.
> 2. A customer who is short measured by 10mm on a £3 pint is robbed of 26.4
> pence. How do they get away with it?
A) your figures seem to indicate a really short glass.
B) I can't remember the last time I got a short pint
C) you can always ask them to top it up which they will almost certainly do.
--
Alex
>On Mon, 22 Nov 2010 23:55:02 +0000, Alex Heney <m...@privacy.net>
>wrote:
>
>
><snip>
>
>
>>They probably are, you just didn't see them.
>
>
>How on earth can you say that?
>
I just type the words.
If what you really mean is how on earth can I think that, then it is
simply because in my experience, it is very uncommon indeed to find a
pub in which the price list is not displayed.
>
>>I have yet to visit any pub where I have looked and been unable to
>>easily find the price list.
>
>
>
>You have already told us that you do not go in to pubs very often - so
>you won't have checked very many.
>
Everything you say in that statement is simply wrong.
>Why, as a matter of interest, were you looking for the price list,
>surely you could "guesstimate" the prices :-)
Partly just because of my interest in the law, knowing they *should*
have a list,so looking to see if they do.
At times when I have been in an unfamiliar location, where i have no
baseline to guess against, then I might actually want to know before
ordering, although very rarely.
--
Alex Heney, Global Villager
Always remember you're unique - just like everyone else.
<snip>
>> Do you think it is ok for the pub to not display the price and "get
>> away" with it?
>>
>> You seem to be coming from that point of view.
>
>I have yet to see a pub where the printed price list isn't on display
>somewhere. It's not something that they make a big show of, but it will be
>there.
>That and asking the price is perfectly sufficient for the vast majority of
>the population.
You seem to have missed the question:
>On Tue, 23 Nov 2010 00:05:02 +0000, Alex Heney <m...@privacy.net>
>wrote:
>
>
>
>>>How on earth can you "guesstimate" the price of a pint?
>>>
>>
>>Very easily.
>
>Oh really - please explain.
I did.
>
>I go out for lunch to a village I have not been to for say a year.
>
OK.
You are now shifting the goalposts rather, since I did say " in my own
locality.".
>I go in to a pub - there is no price list.
>
Unusual, but I am sure it does happen very occasionally.
>How do I "geusstimate" the price of the different beers on offer.
>
I don't know you well enough to have any idea how you do it.
>Do you guesstimate all prices of items if they are not on display in
>shops?
>
Of course.
>I can assure you that we go to pubs where the prices of draught beers
>can vary from 1.50 up to 3.50 per pint.
>
You really must learn to respond to what has actually been written.
>There is no way to "guesstimate" what the price may be.
>
If you are talking about "specials" then see below (as still quoted).
If you are talking of the difference between a mass produced type
bitter and an expensive beer such as Guinness or Stella, then I
disagree.
the price list is almost always present IME, but I hardly ever look at
it, because I am sure enough of the prices to within a few pence that
I don't need to.
In most pubs in my own locality (or any other locality I visit often
enough to have an i9dea of the "baseline" prices).
>> Obviously any
>>"specials" are likely to be harder to guess, but then I have never
>>seen those without prices, and if you don't now the general level of
>>prices in an area, you are going to find it harder to guess for a
>>particular establishment (having no baseline).
>>
>>People who use pubs more frequently would find it easier than I do.
>>
>>
>>>I know pubs where the price varies by as much as 50% from one pub to
>>>another in a distance of a few hundred yards.
>>>
>>
>>That is not uncommon.
>
>I am unsure how you will know that when you do not go in to pubs all
>that often?
>
Because I do go to pubs. I said I don't go "all that often" because I
know there are a lot of people who will visit pubs several times a
week.
And I am not utterly stupid.
>If we go to a pub for lunch (as we do often) - I want to know what
>different sorts of drinks are on offer and how much they are.
>
>That is quite a simple concept.
Of course it is.
But is also utterly irrelevant to this sub thread (although of course
relevant to the major point of the thread as a whole).
--
Alex Heney, Global Villager
Lottery: A tax on people who are bad at math.
>On Nov 22, 7:55 pm, "Dr Zoidberg" <AlexNOOOOO!!...@drzoidberg.co.uk>
>wrote:
>> "Roland Perry" <rol...@perry.co.uk> wrote in message
>
>> I just don't see it as something that needs to be any more of a legal matter
>> than it already is.
>> As has been established, pubs *do* display prices, they just don't make a
>> huge effort to have them visible, and asking is very simple.
>
>No such generalised truth has been established at all.
The only people who have posted who have not said it is a general
truth in their experience are yourself and Judith.
And neither of you have suggested it might not be.
>
>In my area the vast majority of pubs do NOT put up the prices of the
>regular and ordinary bitters that most of the customers want to drink
>
I simply do not believe you.
It is VERY are in my experience for no price list to be displayed.
Pub landlords aren't stupid. They have no real incentive to NOT
display the list, and know they could be in trouble if they don't.
It isn't a law that is commonly flouted.
>They do display the prices of PIMMS, cocktails, luxury wines, mulled
>wines.
>
>Some of them, if they do post a price list make no effort whatsoever
>to make it easily visible from the bar where one goes to buy that
>beer.
That may well be true.
And is almost certainly also what is actually happening with the ones
you believe do not have a price list.
But I don't believe they often do even that out of malice, but more
out of not wanting to take up space.
--
Alex Heney, Global Villager
Breathing may be hazardous to your health.
>Two points.
>
>1. If I fail to ask for the price of a pint before ordering it and the
>barman charges me £15, can I refuse to pay?
I think it depends on whether you drink the pint before refusing to pay.
>2. A customer who is short measured by 10mm on a £3 pint is robbed of
>26.4 pence. How do they get away with it?
Let us do the sums on this.
A GBP3 pint is likely to be somewhere between 3 and 5% ABV. Maybe a bit
higher, maybe a bit lower, but around that sort of region.
10ml [1] @ 5% is likely to be around .05 alcohol units. What is the
problem?
[1] I am not sure why Mr Williams chose mm rather than ml as I think
most of the licensing laws work on volume rather than height. I suppose
it is possible that Saxman's pub has tulip shaped glasses [2] and 10mm
might count.
[2] narrow at the bottom, very wide at the top.
This is not an appropriate response to another uklm poster. You may
suggest they are mistaken or confused, but not that they are dishonest.
There is an ill-tempered and personalised undertone to some recent posts in
this thread, please can we desist. It's only beer.... :o)
The law says that prices must be displayed in a conspicuous place, , not
just displayed. In that sense I certainly agree with the PP that the law
is regularly flouted. In some pubs, the price list is actually on the
back wall behind the bar, where one can't see it at all.
--
Les
Anyone regularly attending or organising protests should expect to be of
interest to the state.
No we are talking about a potential range of prices for a beer from
around £1.80 a pint up to roughly £4.00 a pint
Pennies no. Pounds yes.
> I'm on the side of folks that sort of know how much a pint is going to
> cost before ordering and expect to have enough money in my pocket at the
> time that I place my order.
How much should I enter a pub with in my wallet? .£50?
I am on the side of the guy who wants to know how much he is going to
pay for something before buying it.
I am on the side of the guy who wants a verifiable source of the price
he is going to pay for a beer.
Who prevents the bar staff from cheating you, if there is no price
list?
> I would not expect to visit my local pub without being able to pay for
> what I had ordered.
OK. but what if you were in strange town? How much then?
Is that in the charter?
>Alex Heney wrote:
>> On Tue, 23 Nov 2010 12:50:02 +0000, A UK Citizen
>> <cjdro...@gmail.com> wrote:
>>> In my area the vast majority of pubs do NOT put up the prices of
>>> the regular and ordinary bitters that most of the customers want
>>> to drink
>>
>> I simply do not believe you.
>
>This is not an appropriate response to another uklm poster. You may
>suggest they are mistaken or confused, but not that they are dishonest.
There was no such suggestion.
I made it quite clear in the rest of the post that I believed him
mistaken.
>
>There is an ill-tempered and personalised undertone to some recent posts in
>this thread, please can we desist. It's only beer.... :o)
>
There is no intention from me to insult anybody in this thread.
If some of what I have written could be taken that way, I apologise.
--
Alex Heney, Global Villager
If wishes were horses, dogfood would be a lot cheaper.
Except in Holland, of course
Hey - we've not been out for that drink yet ...
--
geoff
a) Contributors are permitted to express strong disagreement using whatever
language they wish, but if they post offensive personal remarks about
another contributor the post will normally be rejected. (NB - posts will
normally be rejected if they imply that another contributor who is likely to
see the post is stupid or dishonest, regardless of whether such observations
contain any truth)
http://www.uklegal.fsnet.co.uk/ulm.htm
Thank you for clarifying that, Alex.
>Alex Heney <m...@privacy.net> posted
>>It is VERY are in my experience for no price list to be displayed.
>>
>>Pub landlords aren't stupid. They have no real incentive to NOT
>>display the list, and know they could be in trouble if they don't.
>>
>>It isn't a law that is commonly flouted.
>
>
>The law says that prices must be displayed in a conspicuous place, ,
>not just displayed. In that sense I certainly agree with the PP that
>the law is regularly flouted. In some pubs, the price list is actually
>on the back wall behind the bar, where one can't see it at all.
How can you not see it when you know where it is?
>>In some pubs, the price list is actually on the back wall behind the
>>bar, where one can't see it at all.
>
>How can you not see it when you know where it is?
Perhaps he meant that you can't read it? I wonder what the law says
about the point-size of the print and how near you must be able to get
to it.
--
Roland Perry
On Nov 24, 12:00 am, Alex Heney <m...@privacy.net> wrote:
> That may well be true.
>
> And is almost certainly also what is actually happening with the ones
> you believe do not have a price list.
>
> But I don't believe they often do even that out of malice, but more
> out of not wanting to take up space.
No way Jose. If the publican was being absolutely honest about
advertising the price of his beers, he would hang a price tag on the
pump serving that beer for all to see clearly and plainly. No excess
space taken up whatsoever.
The prices aren't visible for all to see because the publican just
expects people to come to the bar and order drinks ignorant of the
prices, until after they have paid. The consumer is being taken
advantage of. It's a silent con.
Here's a very plain and straightforward chapter written by Charles
Babbage in 1851 about the importance of the visibility of prices
...
The absence of a marked price upon an article, tends to defeat the
effect of competition, as well as to produce loss of time both to
consumer and vendor. It is therefore, to a certain extent, a cause of
increase of price.
...
Exactly! At my local they've even got the price on some of their optics
- but it's a marketing thing, they are advertising the apparently low
price of their "house spirits".
--
Roland Perry
dunno
If we extend this to visually impaired or blind people I think we get
sort of stuck.
My guess would be that a person with a visual impairment would probably
just ask before ordering if they were concerned about the price of a
pint.
Does anyone have a blind friend that they can double check that with? I
would not like to misrepresent people with visual impairment.
>Exactly! At my local they've even got the price on some of their optics
>- but it's a marketing thing, they are advertising the apparently low
>price of their "house spirits".
Do "house spirits" require exorcism?
Curious minds, etc :)
No, just drinking. I think that's what they call them (by analogy with
"House Wine"). In other words, whatever less-well-known brand was on
offer at the cash-and-carry.
--
Roland Perry
And "beware of the leopard" signs in the vicinity!
> The consumer is being taken
> advantage of. It's a silent con.
I haven't been in a pub for a long time. I went to one in "t'North" last
weekend and ordered a pint of beer. It cost £3. No mention of this
anywhere visible in the pub. I've no idea how typical this price is, but
it puts me off going into that pub again.
>> The consumer is being taken
>> advantage of. It's a silent con.
>I haven't been in a pub for a long time. I went to one in "t'North" last
>weekend and ordered a pint of beer. It cost =A33. No mention of this
>anywhere visible in the pub. I've no idea how typical this price is, but
>it puts me off going into that pub again.
Cheapest pub in my area is �2.50, most expensive is �3.30
(That I know of).
--
Cynic
There is no average. We range from £1.80 to £3.80 in the space of 100
metres and they both look equally downtrodden
The worse difference I've come across was Manchester, the same beer in
differnet pubs right across the walkway. A quid difference. No idea what
that justification was.
The lower cost pub had the better beer at that and more friendly bar staff.
You just can't tell
>
------------------------------------------------------------------------
I think you can.
A pub that keeps its beer in good condition will almost always be cheaper
because it will sell more of it.
Invariably, a pub whose standard customer buys fizzy larger and those
newfangled trendy bottled drinks with have shitty beer at a high(er) price
tim
To be really awkward, I would ask my nearly blind friend to do it.
Unless the pub had the price list available in 36pt letters or have an
audio recording of the prices, it would be perfectly reasonable for a
visually impaired customer to ask the prices, and if he were thrown
out for this, the bar would face an expensive disability
discrimination lawsuit.
You shouldn't have to play a guessing game of how much the price of
beer is going to be before buying. The prices should be plainly and
clearly visible from the bar "Before You Attempt To Purchase", not on
some wall behind the bar in 6 point print face, nor hidden in dark
alcove invisible and unreadable. If the pint is £3.40p I want to be
able to see that. I also want to know the beer's strength. I want to
know if I am getting true value for money.
> The worse difference I've come across was Manchester, the same
> beer in differnet pubs right across the walkway. A quid
> difference. No idea what that justification was.
Perhaps they have less business, so are trying to make up for it by
having higher prices.
> You shouldn't have to play a guessing game of how much the price of
> beer is going to be before buying. The prices should be plainly and
> clearly visible from the bar "Before You Attempt To Purchase", not on
> some wall behind the bar in 6 point print face, nor hidden in dark
> alcove invisible and unreadable. If the pint is £3.40p I want to be
> able to see that. I also want to know the beer's strength. I want to
> know if I am getting true value for money.
HEAR! HEAR!
This country is full of Robbin B*******.
Sorry, I have had a drink! However, in the last week I've been ripped
off £60+ for changing my vehicle with an insurance company.
Also, telephone companies sneak in charges for dialing from the 1471
number and ring-backs.
Canceling contracts........you name it.
There is not enough consumer protection.
You name it, airlines, utilities, bars, hotels, restaurants, banks,
transport operators, garages, taxis..........
--
DNA signature encryption key........
ATTGGTGCATTACTTCAGGCTCT
> Perhaps they have less business, so are trying to make up for it by
> having higher prices.
I think there are plenty of examples of this everywhere. Even a 20p
mark up can make considerable differences to ones finances over a year.
Be more selective on bottled beer.
You can want what you like, but there doesn't appear to be a law that
says you must get it.
One particular pub I visit charges £1/pint at certain times of the
day, and £3.60 for the same pint at others. Odd, but fair enough, as
long as it's obvious - in this case, they highlight the "£1 until
10pm" or whatever that days price is, and hope no one notices the
price after that.
Another charges £1.80 during the day, then increases prices to £3.80
and "Buy One Get One Free" after 8pm. Highly dubious practice, the
legality of which I have my suspicions about.
I tend to stick to my local, which charges £2.10/pint for my usual.
You shouldn't have to, agreed.
But the old law which required specific display of all prices if the
pub sold less than 30 products,or of 30 if they sold more was revoked,
and replaced by much more woolly rules by the Consumer Protection from
Unfair Trading Regulations 2008
http://www.legislation.gov.uk/uksi/2008/1277/made
The relevant part of those regulations are in regulation 6.
--
Alex Heney, Global Villager
1200 bps used to seem so fast
>On Sat, 27 Nov 2010 18:50:04 +0000, A UK Citizen
><cjdro...@gmail.com> wrote:
>
>>> The lower cost pub had the better beer at that and more friendly bar staff.
>>>
>>> You just can't tell
>>>
>>> ------------------------------------------------------------------------
>>>
>>> I think you can.
>>>
>>> A pub that keeps its beer in good condition will almost always be cheaper
>>> because it will sell more of it.
>>>
>>> Invariably, a pub whose standard customer buys fizzy larger and those
>>> newfangled trendy bottled drinks with have shitty beer at a high(er) price
>>
>>You shouldn't have to play a guessing game of how much the price of
>>beer is going to be before buying.<snip>
>
>You shouldn't have to, agreed.
And in fact you don't have to.
>But the old law which required specific display of all prices if the
>pub sold less than 30 products,or of 30 if they sold more was revoked,
>and replaced by much more woolly rules by the Consumer Protection from
>Unfair Trading Regulations 2008
>
>http://www.legislation.gov.uk/uksi/2008/1277/made
>
>The relevant part of those regulations are in regulation 6.
Which includes:
Where a commercial practice is an invitation to purchase, the
following information will be material if not already apparent from
the context in addition to any other information which is material
information under paragraph (3)
(d)either
(i)the price, including any taxes; or
(ii)where the nature of the product is such that the price cannot
reasonably be calculated in advance, the manner in which the price is
calculated.
Seems quite clear to me - prices need to be displayed otherwise the
law has been broken.
If it seems that clear to you, then you haven't read the law properly.
There are exceptions, and caveats about doing it differently.
Previously, it was quite clear, now it is very much more woolly.
First, there is no the important phrase in para 1 "and as a result it
causes or is likely to cause the average consumer to take a
transactional decision he would not have taken otherwise."
Many publicans would argue (and probably correctly) that the "average
consumer" is not going to quibble about the price of a drink unless it
is significantly more expensive than in other establishments, so that
phrase would probably let them out.
Then, all the matters in para 2 have to be taken into account whe3n
deciding if it is a "misleading practice".
--
Alex Heney, Global Villager
Managing programmers is like herding cats.