tophat2: Warning: TopHat did not find any junctions in GTF file

yangf...@gmail.com

unread,

Mar 9, 2016, 6:44:14 AM3/9/16

to Tuxedo Tools Users

I'm running tophat v2.1.0 on a Eukaryotic genome using the gff file download from the NCBI FTP. when trying map to genome get a warning:

[2016-03-09 11:31:39] Beginning TopHat run (v2.1.0)
-----------------------------------------------
[2016-03-09 11:31:39] Checking for Bowtie
Bowtie version: 2.2.7.0
[2016-03-09 11:31:40] Checking for Bowtie index files (genome)..
[2016-03-09 11:31:40] Checking for reference FASTA file
[2016-03-09 11:31:40] Generating SAM header for /home/yangfang/RNA_seq_wo
rk/work/ref2/C_A_ref
[2016-03-09 11:31:40] Reading known junctions from GTF file
Warning: TopHat did not find any junctions in GTF file
[2016-03-09 11:31:40] Preparing reads

the genome and gff file all download from the NCBI genome Database

My genome file head :

>NW_139667.1
gaacaacaacaattcttTCGATTGCAATAGTATCCAAGCACTACTACTGAGCAACCAGTTTTGGAATAACGTA
TACCAAGAAATGAAAGATGATAGTCTACAGTCAACTTTCGATTACTTTCCCTTACTCCCTAACAGAGCAATTCTTTCCCA
GTTTTAC

the gff file head:

##gff-version 3
#!gff-spec-version 1.21
#!processor NCBI annotwriter
#!genome-build ASM18296v2
#!genome-build-accession NCBI_Assembly:GCF_000182965.2
##sequence-region NW_139667.1 1 26723
##species http://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=237561
NW_139667.1     RefSeq region 1       26723   .       +       .       ID=id0;Dbxref=taxon:237561;Name=1;chromosome=1;gbkey=Src;genome=genomic;mol_type=genomic DNA;strain=SC5314
NW_139667.1     RefSeq gene    83      652     .       +       .       ID=gene0;Dbxref=GeneID:3647715;Name=CaO19.1597;gbkey=Gene;gene_biotype=protein_coding;locus_tag=CaO19.1597
NW_139667.1     RefSeq mRNA    83      652     .       +       .       ID=rna0;Parent=gene0;Dbxref=Genbank:XM_705586.1,GeneID:3647715;Name=XM_705586.1;gbkey=mRNA;product=hypothetical protein;transcript_id=XM_705586.1

run tophat2 with command:tophat2 -p 6 -o output_gff -r 50 -G C_A_ref.gff C_A_ref CA-1_S67_L004.fa_1.fa CA-1_S67_L004.fa_2.fa

I check the all of the first col(NW_139667.1) in gff file are match with the genome file, but when I runing tophat2 get this warning. Anybody know what the problem is? or who can tell what's wrong with me?

Thanks

Yang fang

Manoharan Kumar

unread,

Apr 8, 2016, 4:39:35 AM4/8/16

to Tuxedo Tools Users

Hi Yang fang,

Did you find the answer I am also getting same warning.

Thank you,

Best Regards,
Manoharan

yangf...@gmail.com

unread,

Apr 10, 2016, 1:29:17 AM4/10/16

to Tuxedo Tools Users

Hi Manoharan，

I tried many ways but still not resolved this question, I think the problem is the gff or gtf file, finally I do maping with tophat2 discard the -G parameter.

if you try solve this problem and succeeded please let me know!

Best Regrds

Yang Fang

Reply all

Reply to author

Forward