Could not run Trinity using sample data

[Nihar]

Hi, I am new to transcriptomics and I have very little knowledge about writing scripts. I am trying to work with Trinity to check how it works and I am using Cygwin to run Trinityv2.5.1 with provided sample data. I am getting error message saying I am missing Trinity-specific tool (Parafly/seqtk etc). Should use virtual box instead Cygwin? I appreciate any suggestions and comments. Thanks

nrd8709@BIOL-112912 ~/trinityrnaseq-Trinity-v2.5.1/sample_data/test_Trinity_Assembly

$ ./runMe.sh

#!/bin/bash -ve

#######################################################

##  Run Trinity to Generate Transcriptome Assemblies ##

#######################################################

../../Trinity --seqType fq --max_memory 2G \

              --left reads.left.fq.gz \

              --right reads.right.fq.gz \

              --SS_lib_type RF \

              --CPU 4

which: no seqtk-trinity in (/home/nrd8709/trinityrnaseq-Trinity-v2.5.1/trinity-plugins/BIN:/usr/local/bin:/usr/bin:/cygdrive/c/ProgramData/Oracle/Java/javapath:/cygdrive/c/Program Files (x86)/MEGA6:/cygdrive/c/Windows/system32:/cygdrive/c/Windows:/cygdrive/c/Windows/System32/Wbem:/cygdrive/c/Windows/System32/WindowsPowerShell/v1.0:/cygdrive/c/Dwimperl/perl/bin:/cygdrive/c/Dwimperl/perl/site/bin:/cygdrive/c/Dwimperl/c/bin:/cygdrive/c/Program Files (x86)/Java/jre1.8.0_131/bin)

        Error, cannot locate Trinity-specific tool: seqtk-trinity in the PATH setting: /home/nrd8709/trinityrnaseq-Trinity-v2.5.1/trinity-plugins/BIN:/usr/local/bin:/usr/bin:/cygdrive/c/ProgramData/Oracle/Java/javapath:/cygdrive/c/Program Files (x86)/MEGA6:/cygdrive/c/Windows/system32:/cygdrive/c/Windows:/cygdrive/c/Windows/System32/Wbem:/cygdrive/c/Windows/System32/WindowsPowerShell/v1.0:/cygdrive/c/Dwimperl/perl/bin:/cygdrive/c/Dwimperl/perl/site/bin:/cygdrive/c/Dwimperl/c/bin:/cygdrive/c/Program Files (x86)/Java/jre1.8.0_131/bin,  be sure to install Trinity by running 'make' in the base installation directory

[Nihar]

I forgot to mention I am using a PC machine and Cygwin for obtaining Linux environment. 

[Will Holtz]

Hi Nihar,

I think you'll have an easier time and get better support if you run a Linux virtual machine on top of your Windows host, rather than trying to use Cygwin. You could directly use VirtualBox as you mention, but I personally prefer to use Vagrant to manage local VMs.

-Will

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.
To post to this group, send email to trinityrnaseq-users@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

[Nihar]

Hi Will,

Thank you very much, I am running vBox without Vagrant and it seems it's running atleast. I was having memory issue so I resized the hard-disk and it's still running out of memory. My data set is 93gb (unzipped) and I allocated around 300GB hard drive storage. Running my dataset from host (windows) as guest addition so it doesn't take up vBox space. It's still running so I don't know this time it would work or not. 

Anyway I was wondering if I can upgrade Trinity within vBox edition as the existing version I have is 2.1. Do you have any suggestions?

Thanks,

Nihar 

On Saturday, December 23, 2017 at 4:45:58 PM UTC-6, Will Holtz wrote:

Hi Nihar,

I think you'll have an easier time and get better support if you run a Linux virtual machine on top of your Windows host, rather than trying to use Cygwin. You could directly use VirtualBox as you mention, but I personally prefer to use Vagrant to manage local VMs.

-Will

On Sat, Dec 23, 2017 at 12:11 PM, Nihar <nd1...@gmail.com> wrote:

I forgot to mention I am using a PC machine and Cygwin for obtaining Linux environment. 

On Saturday, December 23, 2017 at 2:07:19 PM UTC-6, Nihar wrote:

Hi, I am new to transcriptomics and I have very little knowledge about writing scripts. I am trying to work with Trinity to check how it works and I am using Cygwin to run Trinityv2.5.1 with provided sample data. I am getting error message saying I am missing Trinity-specific tool (Parafly/seqtk etc). Should use virtual box instead Cygwin? I appreciate any suggestions and comments. Thanks

nrd8709@BIOL-112912 ~/trinityrnaseq-Trinity-v2.5.1/sample_data/test_Trinity_Assembly

$ ./runMe.sh

#!/bin/bash -ve

#######################################################

##  Run Trinity to Generate Transcriptome Assemblies ##

#######################################################

../../Trinity --seqType fq --max_memory 2G \

              --left reads.left.fq.gz \

              --right reads.right.fq.gz \

              --SS_lib_type RF \

              --CPU 4

which: no seqtk-trinity in (/home/nrd8709/trinityrnaseq-Trinity-v2.5.1/trinity-plugins/BIN:/usr/local/bin:/usr/bin:/cygdrive/c/ProgramData/Oracle/Java/javapath:/cygdrive/c/Program Files (x86)/MEGA6:/cygdrive/c/Windows/system32:/cygdrive/c/Windows:/cygdrive/c/Windows/System32/Wbem:/cygdrive/c/Windows/System32/WindowsPowerShell/v1.0:/cygdrive/c/Dwimperl/perl/bin:/cygdrive/c/Dwimperl/perl/site/bin:/cygdrive/c/Dwimperl/c/bin:/cygdrive/c/Program Files (x86)/Java/jre1.8.0_131/bin)

        Error, cannot locate Trinity-specific tool: seqtk-trinity in the PATH setting: /home/nrd8709/trinityrnaseq-Trinity-v2.5.1/trinity-plugins/BIN:/usr/local/bin:/usr/bin:/cygdrive/c/ProgramData/Oracle/Java/javapath:/cygdrive/c/Program Files (x86)/MEGA6:/cygdrive/c/Windows/system32:/cygdrive/c/Windows:/cygdrive/c/Windows/System32/Wbem:/cygdrive/c/Windows/System32/WindowsPowerShell/v1.0:/cygdrive/c/Dwimperl/perl/bin:/cygdrive/c/Dwimperl/perl/site/bin:/cygdrive/c/Dwimperl/c/bin:/cygdrive/c/Program Files (x86)/Java/jre1.8.0_131/bin,  be sure to install Trinity by running 'make' in the base installation directory

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.

Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

[Will Holtz]

Hi Nihar,

You should be able to build and run the current version of Trinity in a separate directory.

https://github.com/trinityrnaseq/trinityrnaseq/wiki/Installing-Trinity

-Will

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--

You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrnaseq-users@googlegroups.com.

Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

[Nihar]

Hi,

Everytime I am trying to run using virtualbox it gets stuck saying "If it indicates bad_alloc(), then Inchworm ran out of memory.  You'll need to either reduce the size of your data set or run Trinity on a server with more memory available."

I downloaded the vbox file from https://github.com/trinityrnaseq/RNASeq_Trinity_Tuxedo_Workshop/wiki/Import-and-run-workshop-VM

I am not sure if this was created for tutorial purpose only and/or if it is possible to run for actual analysis with huge dataset. I am leaning towards installing Linux or running my data using Galaxy server.

Thanks,

Nihar

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--

You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

[Brian Haas]

Hi Nihar,

The virtualbox stuff was set up just for running the tutorials with small data sets.   For any production runs with real data, you'll probably want to run it directly on linux or otherwise outside of virtualbox.

best,

~b

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--

You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrnaseq-users@googlegroups.com.

Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

--
Brian J. Haas
The Broad Institute
http://broadinstitute.org/~bhaas

 

[Nihar deb adhikary]

Dr. Haas,

Thank you very much. I have over 100 million reads and I have 64Gb ram. I am aware of 1Gb ram per 1mil reads. So is my system okay to run all my samples at one run?

Regards,

Nihar

To post to this group, send email to trinityrnaseq-users@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

[Mark Chapman]

Hi Nihar,

Make sure you run the normalisation step. This will definitely reduce the amount of memory needed. This happens by default in the newer versions of trinity anyway but you can run it on its own first if you prefer.

--Mark

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrnaseq-users@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

Dr. Mark A. Chapman

M.Ch...@soton.ac.uk

+44 (0)2380 594396

------------------------------------

Biological Sciences
University of Southampton

Life Sciences Building 85
Highfield Campus
Southampton
SO17 1BJ

[Nihar]

Hi,
So I not I am trying Ubuntu in virtual box and while trying to install using "make" command (https://github.com/trinityrnaseq/trinityrnaseq/wiki/Installing-Trinity) it looks like few dependencies are not installed properly.

First, "Error, cannot locate Trinity-specific tool: Parafly-trinity in the PATH setting:....."
so I copied Parafly from $/trinityrnaseq-devel/trinity-plugins/parafly/bin/ParaFly $/trinityrnaseq-devel/trinity-plugins/BIN/

Ran it again, "Error, cannot locate Trinity-specific tool: seqtk-trinity in the PATH setting:..."
Only this time copy-paste did not solve the problem, then I went to base directory and tried to run "make" it showed me "seqtk.c:31:18: fatal error: zlib.h: No such file or directory
compilation terminated.
Makefile:7: recipe for target 'seqtk-trinity' failed"

I saw couple of posts related to this issue but could not figure it out.

I appreciate for your time,
Nihar

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--

You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

--
Brian J. Haas
The Broad Institute
http://broadinstitute.org/~bhaas

 

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

[Nihar]

By the way, I was running the sample data.

[Will Holtz]

Hi Nihar,

Under Ubuntu 16.04 the dependencies for Trinity v2.5.1 can be satisfied with:

sudo apt-get update

sudo apt-get install -y build-essential bowtie samtools  zlib1g-dev  libncurses5-dev  openjdk-8-jdk

-Will

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--

You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

The information contained in this e-mail message or any attachment(s) may be confidential and/or privileged and is intended for use only by the individual(s) to whom this message is addressed.  If you are not the intended recipient, any dissemination, distribution, copying, or use is strictly prohibited.  If you receive this e-mail message in error, please e-mail the sender at who...@lygos.com and destroy this message and remove the transmission from all computer directories (including e-mail servers).

Please consider the environment before printing this email.

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

--
Brian J. Haas
The Broad Institute
http://broadinstitute.org/~bhaas

 

--
You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsubscribe...@googlegroups.com.

To post to this group, send email to trinityrn...@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

Dr. Mark A. Chapman

M.Ch...@soton.ac.uk

+44 (0)2380 594396

------------------------------------

Biological Sciences
University of Southampton

Life Sciences Building 85
Highfield Campus
Southampton
SO17 1BJ

--

You received this message because you are subscribed to the Google Groups "trinityrnaseq-users" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrnaseq-users@googlegroups.com.

Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

[Nihar deb adhikary]

Thanks Will,

It works. When I am running my analysis I get an ERROR now (I am using "--no_bowtie"),

"Monday, January 1, 2018: 16:02:10    CMD: touch /home/nihar/Documents/trinityrnaseq-Trinity-v2.5.1/trinity_out_dir/inchworm.K25.L25.DS.fa.finished
NON_FATAL_EXCEPTION: WARNING, no Inchworm output is detected at: /home/nihar/Documents/trinityrnaseq-Trinity-v2.5.1/trinity_out_dir/inchworm.K25.L25.DS.fa at ./Trinity line 1616.



###################################################################
Trinity assemblies are written to /home/nihar/Documents/trinityrnaseq-Trinity-v2.5.1/trinity_out_dir/Trinity.fasta
###################################################################


Argument "NA" isn't numeric in subtraction (-) at ./Trinity line 2830.
Argument "NA" isn't numeric in subtraction (-) at ./Trinity line 2830.
"

And it stops right there.

Can you please help me out.

Regards,

Nihar

To post to this group, send email to trinityrnaseq-users@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

[Brian Haas]

Hi Nihar,

This will happen if you run it with data that it can't assemble.  Can you try running it with the sample data set and see if it works, if that's not what you're already doing?

~brian

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrnaseq-users@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

[Nihar deb adhikary]

It worked with sample dataset. 

[Mark Chapman]

Hi Nihar,

If the sample data works and your own data doesn't then as Brian said, and I have experienced, this most likely means that your data is not formatted in the way trinity is expecting. Can you run head on your fasta files and paste it into a reply. Did you get it from sra by any chance?

Thanks, Mark

To unsubscribe from this group and stop receiving emails from it, send an email to trinityrnaseq-users+unsub...@googlegroups.com.

To post to this group, send email to trinityrnaseq-users@googlegroups.com.
Visit this group at https://groups.google.com/group/trinityrnaseq-users.
For more options, visit https://groups.google.com/d/optout.

--

[Nihar deb adhikary]

@D00420:143:HC7YNBCXY:1:1101:1499:2147 1:N:0:CGATGT
GCCGTCCCCCGCCCTTTGCAAGACAGGTTCATCCTCTCGCGCGCTTTCCTCCACTTCAGAGAACTGGCCGCATCAAGCCTGCCAGTTCGTGCGGACACGTCCTGGCACCTTCCACGGGGTTTCTTTCCTCTTCGCGACCTGAGTATGA
+
GGGGGIIIIIIIIIIIGIGIIGIIIIIIIIIIGIGIGGIIIIIIIGIGGIIIIIIIIIGIGGGIGIIIIIIIGIIGIIIIGGIIIIIGIIGIIIIIIIIIIGGIIIIIIIIIIIIIIIIGGIIIIIIIIGIIIIGIIIIIIIIIIIAG
@D00420:143:HC7YNBCXY:1:1101:1276:2168 1:N:0:CGATGT
GCGCTTTTGGGCGAGGGTTGACACCCCTTGTTCAGGAGTTGCTGGACCAGAAGGCAGGATGCTTCCCTGCCCGAATAGGCTGTGCGCGCGAACTCGTGCACGCAAACAGCCTTGCTCGAAGTGAGAGAGCACACTTCTTCATCTCGGAC
+
GGGGGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIGGIIIIGIIIIIIIIIIIIIIIIIGGGIIIIIIIIIIIIIIIIIIGGIIIIIIIIIIIGIIIIGIIIIIIII
@D00420:143:HC7YNBCXY:1:1101:1433:2182 1:N:0:CGATGT
CCGAACGACGAACGGGCAGCGTCGAACCCATGCGGCGCAAGGGCTGGTGCTCACAACACGCTGAACGACGGCTCGACCCCAGGAGAGGCACCGTGCGCTGCGGTGACGTGGCGTTCGGAGCGGGGCTCGGCTGGATACTCTGAG

[Nihar deb adhikary]

Mark,
I did not get the data from sra. A sequencing facility call MRDNA in Texas provided me the data.

Please let me know if you have any solution.

Thanks,

Nihar

[Brian Haas]

The read formatting looks fine.   Try rerunning Trinity in a clean workspace, so it doesn't try to reuse any existing files (including some hidden checkpoints).  Let's see if that helps.

best,

~b

[Nihar deb adhikary]

Brian,

I created a new directory and installed trinity. It seems to work now, it's been 12 hours and still running. Thank you all for your help.

Thanks,

Nihar

[Brian Haas]

Great news!  Hopefully smooth sailing.

~b

[Nihar deb adhikary]

Brian,

My computer is still running the process but the computer screen is all black (must be in power saving mode and I could not bring the screen back) since the day after I started running my analysis. I believe the  CPU is still running and it has been almost two weeks. Since I don't want to kill the run ,I have been waiting for it to finish it. I was wondering how long it would take to finish one run, do you think I should restart the machine forcefully!! 

Regards,

Nihar

[Brian Haas]

Hi Nihar,

The runtime experience depends on the machine and the data set and can be highly variable.  We generally recommend ~1G of RAM per ~1 M reads as a very basic estimate.  If the data represent a diverse set of transcripts, then the complexity will be higher and it'll lead to longer runtimes and greater hardware requirements.

I'd never try to run Trinity on a desktop with anything other than a very small sample, unless you have a very powerful desktop. 

best,

~b

[Nihar deb adhikary]

Hello,

So I have tried to use trinity using https://usegalaxy.org/ and https://galaxy.ncgas-trinity.indiana.edu/. In  https://usegalaxy.org/ I started running trinity and then it stopped, later I got to know from the galaxy team that my concatenated file size is too big ~40GB each, here is their email,

"Hello,

The size of the input fastq datasets is very large (~40 GB each). This creates a job that is too large to process at Galaxy Main https://usegalaxy.org.

Thanks, Jen, Galaxy team." 

My work flow was  FASTQC>Trimmomatic>FASTQC>fastq Interlacer> fastq de interlacer>concatenate>trinity.

So it looks like I have to eliminate some datasets so I can further run it. As my goal is to check differential gene expression and I have four experimental conditions with replicates can you please suggest me how should I handle this situation?!? Should assemble (de novo) each dataset separately? 

Regards,

Nihar

[Mark Chapman]

Hi Nihar,

Ideally you'd want to normalise the data to remove redundancy and I am sure this would make your file sizes a lot smaller. I don't think galaxy will do this though.

Could you just assemble using 1/4 of your data? It might not make a huge difference to the assembly but there's a risk that something very lowly expressed might get missed.

Alternatively someone could normalise for you and send the trimmed files back. I can do this if you'd like with the usual guarantee that ill delete all the raw data and not use it blah blah.

Cheers, Mark