Paired-end data - how to run it?

[Chrissie Madden]

Hi,

I'm unsure how to run trans-abyss using paired-end data. Is the command for paired-end data correct?

transabyss --pe test_r1.fastq test_r2.fastq --outdir /home/madden6/assembly --threads 10

Thank you in advance,

Chrissie

[Ka Ming Nip]

Hi Chrissie,

That looks correct to me.

If your reads are strand-specific, then you need to use the `--SS` option.
https://github.com/bcgsc/transabyss/wiki#17-strand-specific-assembly

Ka Ming

--
Ka Ming Nip
Graduate Student | Dr. Inanc Birol Lab (BTL)
Canada's Michael Smith Genome Sciences Centre
________________________________________
From: trans...@googlegroups.com [trans...@googlegroups.com] On Behalf Of Chrissie Madden [chrissi...@gmail.com]
Sent: July 18, 2017 11:11 PM
To: Trans-ABySS
Subject: Paired-end data - how to run it?

--
You received this message because you are subscribed to the Google Groups "Trans-ABySS" group.
To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<mailto:trans-abyss...@googlegroups.com>.
For more options, visit https://groups.google.com/d/optout.

[Ka Ming Nip]

Hi Chrissie,

You only need to specify the `--SS` option if your samples were sequenced in a strand-specific manner. Otherwise, you don't need to specify that option.

But do make sure the read names (not file name) in your "test_r1.fastq" file have a "/1" (not "/r1") suffix, eg.

@Read_Name/1
TCAACCAACTCTGCCAAACTGCATTTCCTGCCTCCTGATCTGGGGTCTTTTCCTTTTCTTTTTTCACACAGGGAG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

Similarly, the read names in the "test_r2.fastq" file have a "/2" suffix, eg.

@Read_Name/2
AGTGGCGCTGAGCCCCGAGCCCAGGCACTGCTACGGTCACCCTTGGTTACTCGGTGATTGATTGATAGGGCTGCA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII


Hope that helps!

Ka Ming

--
Ka Ming Nip
Graduate Student | Dr. Inanc Birol Lab (BTL)
Canada's Michael Smith Genome Sciences Centre
________________________________________
From: trans...@googlegroups.com [trans...@googlegroups.com] On Behalf Of Chrissie Madden [chrissi...@gmail.com]

Sent: July 19, 2017 7:50 PM
To: Trans-ABySS
Subject: Re: Paired-end data - how to run it?

Hi Ka Ming,

Thank you for your reply! I appreciate your help.

According to the link you sent the '--SS' option seems to imply that I must rename my forward (i.e. 5' to 3') reads as /r2 and my reverse reads (3' to 5') reads as /r1. Am I interpreting this correctly?

My script failed, so I am making copies and will rename the files.

Thank you,
Chrissie

On Thursday, July 20, 2017 at 2:15:09 AM UTC+10, Ka Ming Nip wrote:
Hi Chrissie,

That looks correct to me.

If your reads are strand-specific, then you need to use the `--SS` option.
https://github.com/bcgsc/transabyss/wiki#17-strand-specific-assembly

Ka Ming

--
Ka Ming Nip
Graduate Student | Dr. Inanc Birol Lab (BTL)
Canada's Michael Smith Genome Sciences Centre
________________________________________

From: trans...@googlegroups.com<javascript:> [trans...@googlegroups.com<javascript:>] On Behalf Of Chrissie Madden [chrissi...@gmail.com<javascript:>]

Sent: July 18, 2017 11:11 PM
To: Trans-ABySS
Subject: Paired-end data - how to run it?

Hi,

I'm unsure how to run trans-abyss using paired-end data. Is the command for paired-end data correct?

transabyss --pe test_r1.fastq test_r2.fastq --outdir /home/madden6/assembly --threads 10

Thank you in advance,
Chrissie

--
You received this message because you are subscribed to the Google Groups "Trans-ABySS" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<javascript:><mailto:trans-abyss...@googlegroups.com<javascript:>>.

[Chrissie Madden]

Hi Ka Ming,

My script failed again, and I looked at the raw reads but they are in format:

@NS500334:113:HVMCLBGX2:1:11101:18003:1064 1:N:0:GCCAAT

I looked online and it states that this format is the newer format (https://en.wikipedia.org/wiki/FASTQ_format#Illumina_sequence_identifiers).

I have the following script:

$ transabyss --pe R1_all.fastqsanger R2_all.fastqsanger --outdir /home/madden6/assembly --threads 10

Is my file format wrong?

Thank you, kindly.

Chrissie

To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<javascript:><mailto:trans-abyss+unsubscribe@googlegroups.com<javascript:>>.

For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "Trans-ABySS" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<mailto:trans-abyss+unsubscribe@googlegroups.com>.

[Ka Ming Nip]

Hi Chrissie,

The newer format should be supported. Can you report the exact error message?

Also, were you able to assemble the sample dataset? We have a script for this called `assemble.sh` in the `sample_dataset` directory of where Trans-ABySS is installed.

Ka Ming

--
Ka Ming Nip
Graduate Student | Dr. Inanc Birol Lab (BTL)
Canada's Michael Smith Genome Sciences Centre
________________________________________
From: trans...@googlegroups.com [trans...@googlegroups.com] On Behalf Of Chrissie Madden [chrissi...@gmail.com]

Sent: July 23, 2017 6:09 PM

To: Trans-ABySS
Subject: Re: Paired-end data - how to run it?

Hi Ka Ming,

To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<javascript:><mailto:trans-abyss...@googlegroups.com<javascript:><javascript:>>.

For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "Trans-ABySS" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<javascript:><mailto:trans-abyss...@googlegroups.com<javascript:>>.

For more options, visit https://groups.google.com/d/optout.

--
You received this message because you are subscribed to the Google Groups "Trans-ABySS" group.

To unsubscribe from this group and stop receiving emails from it, send an email to trans-abyss...@googlegroups.com<mailto:trans-abyss...@googlegroups.com>.