How to make hapmap file from DArTseq SNP data.

[István Monostori]

Dear All,

Our maize inbreed line collection have been genotyped with maize DArTseq (1.0) by the Diversity Arrays Technology Ltd.

I have already used TASSEL to analyse presence-absence data many times, but I would like to  to analyse SNP data this time,

I have read the online manual but I am not sure how  input the data in the hapmap file to perform GWAS.

 SNP 1 Row Mapping Format coding is the following: "0" = Reference allele homozygote, "1" = SNP allele homozygote,

 "2"= heterozygote and "-" = double null/null allele homozygote (absence of fragment with SNP in genomic representation)

The dataset looks like this:

AlleleID	AlleleSequence	TrimmedSequence	Chrom_Maize_v8	ChromPos_Maize_v8	AlnCnt_Maize_v8	AlnEvalue_Maize_v8	Chrom_Maize_v329	ChromPos_Maize_v329	AlnCnt_Maize_v329	AlnEvalue_Maize_v329	SNP	SnpPosition	CallRate	OneRatioRef	OneRatioSnp	FreqHomRef	FreqHomSnp	FreqHets	PICRef	PICSnp	AvgPIC	AvgCountRef	AvgCountSnp	RepAvg	genotype1	Genotype 20
4585424|F|0-20:A>C-20:A>C	TGCAGGCACCTGAGCGGCTCATACCATGGCTTGTGCGACACCTCCTACACCCCCTGCCTAGATACATGA	TGCAGGCACCTGAGCGGCTCATACCATGGCTTGTGCGACACCTCCTACACCCCCTGCCTAGATACATGA	5 chromosome:AGPv2:5:1:217872852:1 chromosome 5	66000337	1	3.01E-26	5 dna:chromosome	66029138	1	3.01E-26	20:A>C	20	1	0.502703	0.502703	0.497297	0.497297	0.005405	0.499985	0.499985	0.499985	53.46491	49.24786	1	0	0
24026074|F|0-11:G>A-11:G>A	TGCAGAAAGGAGTATGGCCAAAACTTTAAACATGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC	TGCAGAAAGGAGTATGGCCAAAACTTTAAACATG	2 chromosome:AGPv2:2:1:237068873:1 chromosome 2	212362874	1	1.20E-09	2 dna:chromosome	213027563	1	1.20E-09	11:G>A	11	1	0.502703	0.497297	0.502703	0.497297	0	0.499985	0.499985	0.499985	58.9375	61.84746	1	1	1
4582318|F|0-51:T>C-51:T>C	TGCAGGTATTCCCTTGAGGAGCAGGCGCTCGCCGAGCAACTTTCCAATCTTTGCAGCTGCTGCGACGTC	TGCAGGTATTCCCTTGAGGAGCAGGCGCTCGCCGAGCAACTTTCCAATCTTTGCAGCTGCTGCGACGTC	2 chromosome:AGPv2:2:1:237068873:1 chromosome 2	107189279	1	1.80E-28	2 dna:chromosome	107819360	1	1.80E-28	51:T>C	51	1	0.508108	0.497297	0.502703	0.491892	0.005405	0.499869	0.499985	0.499927	27.05882	29.04464	1	0	0

I can find the "chromosome" and the "position". I also know what is the SNP, e.g.

SNP

20:A>C

11:G>A

51:T>C

But I do not know how to code it according to "Nucleotide Codes (Derived from IUPAC)"

for example how to code a heterozygote?

Can someone tell me how to do that or send some example.

Thank you for your help!

István

[vln reddy]

Is it possible to use indel data for TASSEL?

**********************************************************************

Lakshmi Narayana R Vemireddy, PhD
Assistant Professor

Department of Genetics and Plant Breeding

S.V. Agricultural College
Acharya NG Ranga Agricultural University (ANGRAU)
TIRUPATI-517502, AP, INDIA

Ph:  +91-9440440433 (M)

 www.angrau.ac.in ; http://www.svagcollege.org/

Other mail IDs: vlnr...@rediffmail.com

                                vlnr...@gmail.com

https://scholar.google.co.in/citations?user=OvNcCCUAAAAJ&hl=en
**********************************************************************

-Start by doing what is necessary, then what is possible, suddenly you are doing the impossible

--
You received this message because you are subscribed to the Google Groups "TASSEL - Trait Analysis by Association, Evolution and Linkage" group.
To unsubscribe from this group and stop receiving emails from it, send an email to tassel+un...@googlegroups.com.
To post to this group, send email to tas...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/tassel/5f0849eb-6d58-45da-baf8-47f84665148e%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

[Peter Bradbury]

See the TASSEL 5 Users Manual at https://bitbucket.org/tasseladmin/tassel-5-source/wiki/Home. In the Hapmap section, the example given uses the two nucleotide format, where a heterozygote would be AC, for example. There is an appendix listing the single IUPAC nucleotide codes that be can used instead.

Peter

[Kate Quigley]

Hi István,

Did you ever figure out how to hapmap file from DArTseq SNP data? If so, would you mind sharing your code with me?

Thank you,

Kate

[Kwame Shamuyarira]

Hi Kate

Did you manage to figure out how to convert the data? Or did anyone else? 

Your assistance will be much appreciated.

Regards