How to make hapmap file from DArTseq SNP data.

440 views
Skip to first unread message

István Monostori

unread,
Jul 6, 2018, 3:34:09 AM7/6/18
to TASSEL - Trait Analysis by Association, Evolution and Linkage
Dear All,

Our maize inbreed line collection have been genotyped with maize DArTseq (1.0) by the Diversity Arrays Technology Ltd.
I have already used TASSEL to analyse presence-absence data many times, but I would like to  to analyse SNP data this time,
I have read the online manual but I am not sure how  input the data in the hapmap file to perform GWAS.

 SNP 1 Row Mapping Format coding is the following: "0" = Reference allele homozygote, "1" = SNP allele homozygote,
 "2"= heterozygote and "-" = double null/null allele homozygote (absence of fragment with SNP in genomic representation)

The dataset looks like this:

AlleleID AlleleSequence TrimmedSequence Chrom_Maize_v8 ChromPos_Maize_v8 AlnCnt_Maize_v8 AlnEvalue_Maize_v8 Chrom_Maize_v329 ChromPos_Maize_v329 AlnCnt_Maize_v329 AlnEvalue_Maize_v329 SNP SnpPosition CallRate OneRatioRef OneRatioSnp FreqHomRef FreqHomSnp FreqHets PICRef PICSnp AvgPIC AvgCountRef AvgCountSnp RepAvg genotype1 Genotype 20
4585424|F|0-20:A>C-20:A>C TGCAGGCACCTGAGCGGCTCATACCATGGCTTGTGCGACACCTCCTACACCCCCTGCCTAGATACATGA TGCAGGCACCTGAGCGGCTCATACCATGGCTTGTGCGACACCTCCTACACCCCCTGCCTAGATACATGA 5 chromosome:AGPv2:5:1:217872852:1 chromosome 5 66000337 1 3.01E-26 5 dna:chromosome 66029138 1 3.01E-26 20:A>C 20 1 0.502703 0.502703 0.497297 0.497297 0.005405 0.499985 0.499985 0.499985 53.46491 49.24786 1 0 0
24026074|F|0-11:G>A-11:G>A TGCAGAAAGGAGTATGGCCAAAACTTTAAACATGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGAC TGCAGAAAGGAGTATGGCCAAAACTTTAAACATG 2 chromosome:AGPv2:2:1:237068873:1 chromosome 2 212362874 1 1.20E-09 2 dna:chromosome 213027563 1 1.20E-09 11:G>A 11 1 0.502703 0.497297 0.502703 0.497297 0 0.499985 0.499985 0.499985 58.9375 61.84746 1 1 1
4582318|F|0-51:T>C-51:T>C TGCAGGTATTCCCTTGAGGAGCAGGCGCTCGCCGAGCAACTTTCCAATCTTTGCAGCTGCTGCGACGTC TGCAGGTATTCCCTTGAGGAGCAGGCGCTCGCCGAGCAACTTTCCAATCTTTGCAGCTGCTGCGACGTC 2 chromosome:AGPv2:2:1:237068873:1 chromosome 2 107189279 1 1.80E-28 2 dna:chromosome 107819360 1 1.80E-28 51:T>C 51 1 0.508108 0.497297 0.502703 0.491892 0.005405 0.499869 0.499985 0.499927 27.05882 29.04464 1 0 0


I can find the "chromosome" and the "position". I also know what is the SNP, e.g.
  SNP
20:A>C
11:G>A
51:T>C

But I do not know how to code it according to "Nucleotide Codes (Derived from IUPAC)"
for example how to code a heterozygote?

Can someone tell me how to do that or send some example.

Thank you for your help!

István



vln reddy

unread,
Jul 6, 2018, 7:18:35 AM7/6/18
to tas...@googlegroups.com
Is it possible to use indel data for TASSEL?
**********************************************************************
Lakshmi Narayana R Vemireddy, PhD
Assistant Professor
Department of Genetics and Plant Breeding
S.V. Agricultural College
Acharya NG Ranga Agricultural University (ANGRAU)
TIRUPATI-517502, AP, INDIA
Ph:  +91-9440440433 (M)
Other mail IDs: vlnr...@rediffmail.com
                                vlnr...@gmail.com
https://scholar.google.co.in/citations?user=OvNcCCUAAAAJ&hl=en
**********************************************************************
-Start by doing what is necessary, then what is possible, suddenly you are doing the impossible


--
You received this message because you are subscribed to the Google Groups "TASSEL - Trait Analysis by Association, Evolution and Linkage" group.
To unsubscribe from this group and stop receiving emails from it, send an email to tassel+un...@googlegroups.com.
To post to this group, send email to tas...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/tassel/5f0849eb-6d58-45da-baf8-47f84665148e%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.

Peter Bradbury

unread,
Jul 6, 2018, 4:22:54 PM7/6/18
to TASSEL - Trait Analysis by Association, Evolution and Linkage
See the TASSEL 5 Users Manual at https://bitbucket.org/tasseladmin/tassel-5-source/wiki/Home. In the Hapmap section, the example given uses the two nucleotide format, where a heterozygote would be AC, for example. There is an appendix listing the single IUPAC nucleotide codes that be can used instead.

Peter

Kate Quigley

unread,
Sep 3, 2019, 9:59:20 PM9/3/19
to TASSEL - Trait Analysis by Association, Evolution and Linkage
Hi István,
Did you ever figure out how to hapmap file from DArTseq SNP data? If so, would you mind sharing your code with me?
Thank you,
Kate

Kwame Shamuyarira

unread,
Oct 24, 2024, 9:14:30 AM10/24/24
to TASSEL - Trait Analysis by Association, Evolution and Linkage
Hi Kate

Did you manage to figure out how to convert the data? Or did anyone else? 

Your assistance will be much appreciated.

Regards

Reply all
Reply to author
Forward
0 new messages