trouble ligating hexamers into pAAV-TALE backbones

[brian...@gmail.com]

I am trying to ligate 2 hexamers into 2 separate pAAV-TALE(BB)

1. Addgene pAAV_hSyn_TALEBB(HD)-NLS-SID4X_2A_phiLOV2.1_WPRE_bGHpA
(Plasmid #47450)

2. Addgene pAAV_hSyn_TALEBB(HD)-NLS-VP64_2A_GFP_WPRE_bGHpA
(Plasmid #47446)

I am confident that I have the 2 hexamers but the Golden gate reaction seems to constantly not work. So I went ahead and digested the backbones separately with BsaI and ran uncut and cut versions on a gel, but it seems like both these backbones (at least the clones that I have) are not being cut by BsaI.

I wanted to
1. confirm that these plasmids do indeed have BsaI sites that I can use for the ligation (if so, what would just a digestion of these plasmids look like, single or double cut?), and
2. ask for any advice/suggestions that you might have.

Thank you for your response.

Good wishes,

-Brian

[Le Cong]

Hi Brian,

These plasmids should have double BsaI sites for cloning in the repeat monomers as other Zhang lab TALE backbones. But to avoid the possibility that you got a bad clone, I would suggest you sequence the plasmids, e.g. with a Nterm forward primer like TAL-Nterm-F: ACACATGAGGCGATCGTCGG

Although the digestion with BsaI won't release a large enough fragment that you can see on the gel, typically uncut plasmids will mostly assume supercoiled form so you should observe different migration from cut plasmids on a gel, so I think it's worth sequencing the construct to verify.

Best,

Le

Le CONG, Ph.D. 丛乐

Broad Institute of MIT and Harvard,

415 Main Street, Cambridge, MA 02142
HHMI International Research Fellow

Tel: (+1) 617-714-7879

Mobile: (+1) 617-823-6132
E-Mail: congl...@gmail.com / co...@broadinstitute.org / con...@mit.edu

--
You received this message because you are subscribed to the Google Groups "TAL Effectors Discussion Forum" group.
To unsubscribe from this group and stop receiving emails from it, send an email to taleffectors...@googlegroups.com.
To post to this group, send email to taleff...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/taleffectors/be90dbd1-564e-4bd3-ae78-96ddd58c8f7e%40googlegroups.com.
For more options, visit https://groups.google.com/d/optout.