Exemplar alignment contains indel not found in the overlap indel set

82 views
Skip to first unread message

Jason Walker

unread,
Jul 16, 2013, 1:15:51 PM7/16/13
to strelka...@googlegroups.com
I am seeing the following error message.  Any help would be greatly appreciated.  Let me know what additional details I can provide to help troubleshoot.

ERROR: Exception caught in align_pos() while realigning segment: 1 of read: STARLING_READ id: 1159906 genomic_mapping?: tier1-mapped
full_segment_info:
key: HWI-ST485:138468187:D1Y2NACXX:8:1212:16206:71057/2
id: 1159906
seq:  CACGATGCTATGTTTGTGAGCAACAGACCCATGGGGTTTTCAATCCTGCGAAAGAACTGATTGCTAAACTGGAGAAGTATCGAAAAGCAGAGGGTGGTGC
qual: ?A5@DCCAC@9?9@>;55(;A;>CA;@677C;EHE@GDC;3GIHF:A<FDCGGFD?H@IGHB?>HG?CBD@GHAEFAGEEHE>GHFBH?HHDDDD=D@??
GENOME ALIGNMENT pos: 85759165 strand: R path: 95M1I1N4M
is_realigned? 0
buffer_pos: 0
partial_segment 1 :
GENOME ALIGNMENT pos: 85759165 strand: R path: 95M1I
is_realigned? 0
buffer_pos: 85759165
partial_segment 2 :
GENOME ALIGNMENT pos: 85759261 strand: R path: 4M
is_realigned? 0
buffer_pos: 85759261

FATAL_ERROR: strelka EXCEPTION: ERROR: Exemplar alignment contains indel not found in the overlap indel set
        Indel: INDEL pos: 85759260 type: INSERT len: 1 swap_dlen: 0
Exemplar overlap set:

...caught in main()

Saunders, Chris

unread,
Jul 16, 2013, 11:16:26 PM7/16/13
to strelka...@googlegroups.com
Hi Jason,

What version of the workflow were you using? I haven't seen this exact error before, but I know that an indel adjacent to an intro like this has been a source of other problems in the past. Would you able to share a slice of the bam file sufficient to reproduce the issue?

Best,

-Chris



________________________________
From: strelka...@googlegroups.com [strelka...@googlegroups.com] on behalf of Jason Walker [jasonw...@gmail.com]
Sent: Tuesday, July 16, 2013 10:15 AM
To: strelka...@googlegroups.com
Subject: [strelka-discuss] Exemplar alignment contains indel not found in the overlap indel set
--
You received this message because you are subscribed to the Google Groups "strelka-discuss" group.
To unsubscribe from this group and stop receiving emails from it, send an email to strelka-discu...@googlegroups.com.
To post to this group, send email to strelka...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/strelka-discuss/a01e941c-6cb2-41e1-af0a-8ee2633afa51%40googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.


Saunders, Chris

unread,
Jul 19, 2013, 10:16:20 PM7/19/13
to strelka...@googlegroups.com, Sean Davis (sdavis2@mail.nih.gov)

Hi Jason,

 

I just uploaded strelka_workflow v1.0.10 to the ftp site: https://sites.google.com/site/strelkasomaticvariantcaller/home/download

 

This version should fix the issue described in your email below, and (Sean) disables open-breakend output in the indel vcf file. Please let me know if you’re still experiencing trouble.

 

Best,

 

-Chris

--

Pascal Gellert

unread,
Apr 28, 2016, 5:16:10 AM4/28/16
to strelka-discuss
Hi Chris,

I am using v1.0.14 on RNA-Seq data with GSNAP as aligner. I get a similat error, probably it again has something to do with introns and unmapped regions next to each other. Attached is one of the reads that cause the problem.

Thanks for your help,

Pascal



ERROR: Exception caught in align_pos() while realigning segment: 2 of read: STARLING_READ id: 214725 genomic_mapping?: tier1-mapped
full_segment_info:
key: read314064/F_20818/2
id: 214725
seq:  ATGCGGCCTGAATTCGTGCAGTCTTTGTACACTCAGCTTGACGTACTTTAAGCTGTCTGTAGCTGACCAAAACCACCAAGATGGCAGGAATGCAGCAGAGG
qual: DAEC&FFGF?GGEFFGFDGFFFGEBGFE>GGGFGGFGG9FAGFFEG5GFFGGGGFGFGFFGFEDFEGGGGF>FGGGGGG:GB=GEBEF&GGGGGFGGGGGG
GENOME ALIGNMENT pos: 55587264 strand: R path: 22M3808N51I28M
is_realigned? 0
buffer_pos: 0
partial_segment 1 :
GENOME ALIGNMENT pos: 55587264 strand: R path: 22M
is_realigned? 0
buffer_pos: 55587264
partial_segment 2 :
GENOME ALIGNMENT pos: 55591094 strand: R path: 51I28M
is_realigned? 0
buffer_pos: 55591043

FATAL_ERROR: strelka EXCEPTION: ERROR: Exemplar alignment contains indel not found in the overlap indel set
        Indel: INDEL pos: 55591094 type: INSERT len: 51 swap_dlen: 0
Exemplar overlap set:
INDEL pos: 55591072 type: INSERT len: 3 swap_dlen: 0
status: is_present: 0 is_remove_only: 0

...caught in main()
cmdline: strelka-1.0.14/libexec/strelka2 -clobber -filter-unanchored -min-paired-align-score 20 -min-single-align-score 10 -min-qscore 0 -report-range-begin 50000001 -report-range-end 75000000 -samtools-reference human.fa -max-window-mismatch 3 20 -print-used-allele-counts -bam-seq-name chr10 -genome-size 2858674662 -max-indel-size 50 -indel-nonsite-match-prob 0.5 --min-contig-open-end-support 35 --somatic-snv-rate 0.000001 --shared-site-error-rate 0.0000005 --shared-site-error-strand-bias-fraction 0.5 --somatic-indel-rate 0.000001 --shared-indel-error-rate 0.000001 --tier2-min-single-align-score 5 --tier2-min-paired-align-score 5 --tier2-single-align-score-rescue-mode --tier2-mismatch-density-filter-count 10 --tier2-no-filter-unanchored --tier2-indel-nonsite-match-prob 0.25 --tier2-include-singleton --tier2-include-anomalous -bam-file GSNAP.bam --tumor-bam-file GSNAP_tumor.bam --somatic-snv-file chromosomes/chr10/bins/0002/somatic.snvs.unfiltered.vcf --somatic-indel-file chromosomes/chr10/bins/0002/somatic.indels.unfiltered.vcf --variant-window-flank-file 50 chromosomes/chr10/bins/0002/somatic.indels.unfiltered.vcf.window --max-input-depth 10000 --ignore-conflicting-read-names --report-file chromosomes/chr10/bins/0002/strelka.stats

Pascal Gellert

unread,
Apr 28, 2016, 5:16:50 AM4/28/16
to strelka-discuss
The attachment.


On Tuesday, 16 July 2013 19:15:51 UTC+2, Jason Walker wrote:
example.sam

napr

unread,
Feb 17, 2017, 12:20:40 PM2/17/17
to strelka-discuss
Were you able to slove the error you mentioned?
Reply all
Reply to author
Forward
0 new messages