Recommendations for running clone_filter for ddRAD with degenerate bases in P2 adapter

[levine....@gmail.com]

Hi all,

I am hoping I can get some recommendations for how to run clone_filter for my data, and I apologize in advance for my novice understanding. 

My data are ddRAD that were paired-end sequenced on an Illumina HiSeq. While I have sequenced many ddRAD libraries before and analyzed them with Stacks, this is the first time that I used a P2 adapter that has degenerate bases, per Schweyen et al. 2014 (https://www.journals.uchicago.edu/doi/pdf/10.1086/BBLv227n2p146) during my ddRAD library preparation. 

When I ordered my P2 oligos, these were the sequences:

flex_P2.1
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNIIIGG

flex_P2.2_bio
/5Phos/AATTCCIIINNNNNAGATCGGAAGAGCGAGAACAA/3Bio/

Based on this information, could anyone provide some tips on what settings I should select for clone_filter?

Thanks for any information that you can provide, and please let me know what additional info I can give to help.

Sincerely,

Brenna Levine

[Catchen, Julian]

Hi Brenna,

 

You are asking us to interpret your diagrams below but there is a lot of ambiguity. Are your degenerate oligos only on read 2, what kind of barcodes are there, are there extra linker bases (“GG” in your diagram?), what are the “I” characters? It would be more effective if you could tell us what the sequenced reads look like. For example,

 

Read 1:

XXXXXYYYYYZZZZACGTACGTACGT

 

Read 2:

…

 

Where X is the degenerate bases and Y is the barcode and Z is the restriction enzyme cutsite remnant, as an example.

 

With that we could make recommendations to run clone_filter.

 

Best,

 

julian

[levine....@gmail.com]

Hi Julian,

Thank you so much for your response and for your patience with my understanding as I work through this problem.

My degenerate oligos are only on read 2. They are the first 10 bases (highlighted in red) before the cut site remnant (highlighted below in black). My barcodes are on read 1.

TAGAGGGGGGAATTAAGTATTTATTTCAAACTTTAATGTACTTCCGACATAAAACGAGTTTC

Additionally, I have noticed that for some of my reads (particularly those early reads that are prone to lower quality), that there is variability in the length of the degenerate sequence (e.g., sometimes 8 degenerate oligos, sometimes 9, etc.). Is there a way that I can account for this when I run clone_filter? If not, do you have any recommendation for how to deal with this? I expect this has something to do with read quality generally being lower on R2 versus R1.

Thanks so much for your help. Stacks is an excellent program, and I'm excited to try this particular application for the first time.

Please let me know if any additional information would be helpful.

-Brenna

[Catchen, Julian]

Hi Brenna,

 

I would run clone_filter followed by process_radtags. For clone_filter you should be able to specify --null-inline and --oligo-len-2 10 as the command line options. I’m not sure how to handle the case of the degenerate oligo being shorter than expected. First, I would see how often this occurs and ignore the reads where it happened if they are few in number. Second, in process_radtags you could not specify a second restriction enzyme which would cause process_radtags to ignore the cut site remnant in read 2, I think this would be okay as Stacks only expects the single-end read to stack exactly, the second read can vary (as in a randomly sheared standard RAD protocol).

[Brenna Levine]

Thanks, Julian. This is so helpful!

Brenna

--
Stacks website: http://catchenlab.life.illinois.edu/stacks/
---
You received this message because you are subscribed to a topic in the Google Groups "Stacks" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/stacks-users/whxcOKjYAbE/unsubscribe.
To unsubscribe from this group and all its topics, send an email to stacks-users...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/stacks-users/SN6PR11MB2557CBE4E2619ECD11138055A71EA%40SN6PR11MB2557.namprd11.prod.outlook.com.

--

Dr. Brenna Levine, Ph.D. (she/her)

Assistant Professor of Biology

Dorothy and George Hennings College of Science, Mathematics and Technology

Kean University

Lab Website: brenna-levine.weebly.com