John Smith ja geneettinen informaatio

311 views
Skip to first unread message

TJT2

unread,
Jun 3, 2018, 11:51:44 AM6/3/18
to
Siis ateisti John MAYNARD Smith, ei täällä riehuva John "mikälie" Smith
https://en.wikipedia.org/wiki/John_Maynard_Smith
ja paperi
The Concept of Information in Biology
John Maynard Smith

Ja muutama sample niille, jotka eivät jaksa lukea koko pitkää tekstiä. Ja
jos olen oikein ymmärtänyt, eipä täällä taida olla muita kuin Kaj Stenberg,
jolla olisi edes teoreettisia edellytyksiä ymmärtää tämänkään paperin
merkitys.

1. The Information Analogy. The colloquial use of informational terms is
all-pervasive in molecular biology. Transcription, translation, code,
redundancy,
synonymous, messenger, editing, proofreading, library-these
are all technical terms in biology. I am not aware of any confusions arising
because their meanings are not understood. In fact, the similarities between
their meanings when referring to human communication and genetics
are surprisingly close.

2. Weismann and the Non-Inheritance of Acquired Characters. Weismann's
assertion that acquired characters are not inherited is one of the decisive
moments in the history of evolutionary biology. Darwin himself believed
in "the effects of use and disuse." What led Weismann to such a counter-
intuitive notion?


3. The Genetic Code. The analogy between the genetic code and humandesigned
codes such as Morse code or the ASCII code is too close to
require justification. But there are some features that are worth noting:
ii) The genetic code is unusual in that it codes for its own translating
machinery.

4. Symbol and "Gratuity". Jacques Monod's (1971) Chance and Necessity
did not get a good press from philosophers, particularly in the Anglo-
Saxon world. But it contained at least one profound idea, that of gratuite
(translated, not happily, as gratuity). Jacob and Monod (1959) had
discovered
how a gene can be regulated. In effect, a "repressor" protein,
made by a second "regulatory" gene, binds to the gene and switches it off.
The gene can then be switched on by an "inducer," usually a small molecule,
lactose for this particular gene.


5. The Quantification of Evolution. Around 1960, I conceived the idea that,
using information theory, one could quantify evolution simultaneously at
three levels genetic, selective, and morphological. The genetic aspect is
easy: the channel capacity is, approximately, two bits per base. Things are
complicated by the presence of large quantifies of repetitive DNA, but this
can be allowed for. The selective level is tricky, but not hopeless. Suppose
one asks, how much selection is needed to program an initially random
sequence? If, reasonably, the selective removal of half the population is
regarded as adding 1 bit of information, then 2 bits of selection are needed
to program each base.

6. Is the Genome a Developmental Program? There is, I think, no serious
objection to speaking of a genetic code, or to asserting that a gene codes
for the sequence of amino acids in a protein.

7. Evolution Theory and the Concept of Information in Biology.

8. Conclusions
In contrast, the effect of a regulatory protein does depend on an
evolved receiver of the information it carries: the eyeless gene signals
"make
an eye here," but only because the genes concerned with making an eye have
an appropriate receptor sequence. In the same way, the effect of a gene
depends
on the cell's translating machinery ribosomes, tRNAs, and assignment
enzymes. For these reasons, I want to say that genes and regulatory
proteins carry information, but enzymes do not.

Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa koko
kesäksi, ikävää että teikäläisiä ei kiinnosta.

--
--TJT--
Ateisti: "My mind is made up, so don't confuse me with facts!"

Kaj Stenberg

unread,
Jun 4, 2018, 9:19:31 AM6/4/18
to
Den söndag 3 juni 2018 kl. 18:51:44 UTC+3 skrev TJT2:

> Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa koko
> kesäksi, ikävää että teikäläisiä ei kiinnosta.

Uskon että (yksi) ongelmasi on ettet oikeastaan ymmärrä eron
kvalitatiivisen (=onko) ja kvantitativisen (paljonko). _Kukaan_
ei ole kieltänyt etteikö genomissa olisi informaatiota. _Kukaan_
ei myöskään ole tietämätön siitä että ihmisgenomissa on enemmän
on enemmän informaatiota kuin bakteerisolussa.

Se huuhaa tulee siitä kun yrittää saada kvantitatiivisia lukuja ja
verrata ne keskenään. Ei mahdollista, useastakin syystä. (Huomasitko
muuten että tällä kertaa copypastatussa kohdassa 5 puhuttiin
informaation _noususta_?)

--
Kaj

John Smith

unread,
Jun 4, 2018, 11:45:54 AM6/4/18
to
TJT2 wrote:
> Siis ateisti John MAYNARD Smith, ei täällä riehuva John "mikälie" Smith

jumalan rauhaa sielullesi

--
uʍop ǝpᴉs sᴉɥʇ

TJT2

unread,
Jun 5, 2018, 3:54:10 AM6/5/18
to
Kaj Stenberg wrote:
> Den söndag 3 juni 2018 kl. 18:51:44 UTC+3 skrev TJT2:
>> Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa koko
>> kesäksi, ikävää että teikäläisiä ei kiinnosta.
>
> Uskon että (yksi) ongelmasi on ettet oikeastaan ymmärrä eron
> kvalitatiivisen (=onko) ja kvantitativisen (paljonko). Kukaan

Sinulla noita vääriä uskomuksia riittää.

> ei ole kieltänyt etteikö genomissa olisi informaatiota. _Kukaan_
> ei myöskään ole tietämätön siitä että ihmisgenomissa on enemmän
> on enemmän informaatiota kuin bakteerisolussa.

Vaan kummassa on enemmän informaatiota, nykyisessä bakteerisolussa vai siinä
mystisessä alkusolussa? Ja entä kun verrataan mainitsemaasi ihmisgenomia
siihen mystiseen alkusoluun? Siis sehän on aika epäoleellista, kummassa on
enemmän infoa, nykysissä bakteereissa vai nykyisissä ihmisissä, sen sijaan
oleellista on mistä ja miten se nykyisten bakreerien ja nykyisten ihmisten
informaatio on tullut.

> Se huuhaa tulee siitä kun yrittää saada kvantitatiivisia lukuja ja
> verrata ne keskenään. Ei mahdollista, useastakin syystä. (Huomasitko

Sinähän se juuri tuossa vertasit nykybakuja nykyihmisiin. Ja väitit että
ihmisissä enemmän, vaikka et mitään numeroarvoja antanutkaan, vaan enhän
minäkään ole antanut, eikä muut kreationistit. Joten se huuhaa näyttää
tulevan oikeasti siitä, kun yrität kumota jotain itse keksimääsi
"kreationistien" väitettä. Siis pieksät OLKIUKKOA.

> muuten että tällä kertaa copypastatussa kohdassa 5 puhuttiin
> informaation _noususta_?)

Tottakai huomaan mitä itse copypastaan. Ateisiten evotiedemies yrittää
selittää informaation alkuperää ateistisessa konteikstissa, kun ei kykene
näkemään mitään muuta vaihtoehtoa (myöntää suoraan toisen kappaleen
viimeisssä lauseessa, joten copypastaan vitoskohdan 2 ekaa kappaletta)

5. The Quantification of Evolution. Around 1960, I conceived the idea that,
using information theory, one could quantify evolution simultaneously at
three levels genetic, selective, and morphological. The genetic aspect is
easy: the channel capacity is, approximately, two bits per base. Things are
complicated by the presence of large quantifies of repetitive DNA, but this
can be allowed for. The selective level is tricky, but not hopeless. Suppose
one asks, how much selection is needed to program an initially random
sequence? If, reasonably, the selective removal of half the population is
regarded as adding 1 bit of information, then 2 bits of selection are needed
to program each base. The snag is that evolution does not start from a
random sequence. Instead, an already programmed gene (or set of genes)
is duplicated, and then one copy is altered by selection. However, one can
still make a crude estimate of how much selection, measured in bits, is
needed to program an existing genome. Kimura (1961), using Haldane's
(1957) idea of the 'cost of selection', gave a more elegant account of how
natural selection accumulates genetic information in the genome.

The hard step is to quantify morphology, but before tackling that question,
I want to suggest that the quantification of genetic and selective
information in the same units has one, perhaps trivial, use. Occasionally
someone, often a mathematician, will announce that there has not been
time, since the origin of the earth, for natural selection to produce the
astonishing diversity and complexity we see. The odd thing about these
assertions is that, although they sound quantitative, they never tell us
by how much the time would have to be increased: twice as much, or a
million times, or what? The only way I know to give a quantitative answer
is to point out that, if one estimates, however roughly, the quantity of
information in the genome, and the quantity that could have been programmed
by selection in 5000 MY, there has been plenty of time. If, remembering
that for most of the time our ancestors were microbes, we
allow an average of 20 generations a year, there has been time for selection
to program the genome ten times over. But this assumes that the genome
contains enough information to specify the form of the adult. This is a
reasonable assumption, because it is hard to see where else the information
is coming from.

Haldanesta päästäisiin kätevästi kreationisti ReMineen ja hänen paperiinsa
Haldanen dilemmasta, ja ReMinen, Sanfordin ja muiden huipputiedemiesten
koodaamaan evoluutiosimulaattoriin, joka lienee edelleenkin netissä
ladattavissa omalle koneelle. Kyseinen simulaattorikin osoittaa, että ei se
evo toimi ateistien edellyttämällä (luulemalla) tavalla (kun ei toimi
millään tavalla). Mutaatioiden lisäksi myös luonnonvalinta failaa, joten evo
on rikki ihan stereona.

--
--TJT--
Sorry, evolutionists, you were wrong all the time.

Lume Laipio

unread,
Jun 5, 2018, 4:08:16 AM6/5/18
to

"TJT2"


> Sinähän se juuri tuossa vertasit nykybakuja nykyihmisiin. Ja väitit että
> ihmisissä enemmän, vaikka et mitään numeroarvoja antanutkaan, vaan enhän
> minäkään ole antanut, eikä muut kreationistit. Joten se huuhaa näyttää
> tulevan oikeasti siitä, kun yrität kumota jotain itse keksimääsi
> "kreationistien" väitettä. Siis pieksät OLKIUKKOA.

Voithan tykönäsi sopia, että ihmisessä ei ole mitää soluja,
vaan koko ihminen on valmis kokonaisuus, jonka Jumala on luonut
nykyisen kaltaiseksi, hieman Trumpin näköiseksi täydelliseksi
olennoksi Kolmoisvirran maahan, hieman ennen koko maailman
mantereet peittänyttä vedenpaisumusta. Muun näköiset ihmisiksi
itsensä luokittelevat olennot on luonut "joku muu." (Varmaankin
selvää sinulle, kuka!)
Näin pystyt selittämään mm. sinua askarruttavat rodulliset erityispiirteet
ja valkoisen rodun synnynnäisen paremmuuden "niinä oikeina ihmisinä."
Eiks' jeh?


Pekka Ala-Mäyry

unread,
Jun 5, 2018, 2:56:29 PM6/5/18
to
Sun, 03 Jun 2018 18:48:43 +0300, TJT2 kirjoitti:

> Siis ateisti John MAYNARD Smith, ei täällä riehuva John "mikälie" Smith
> https://en.wikipedia.org/wiki/John_Maynard_Smith
> ja paperi
> The Concept of Information in Biology
> John Maynard Smith
>
> Ja muutama sample niille, jotka eivät jaksa lukea koko pitkää tekstiä. Ja
> jos olen oikein ymmärtänyt, eipä täällä taida olla muita kuin Kaj Stenberg,
> jolla olisi edes teoreettisia edellytyksiä ymmärtää tämänkään paperin
> merkitys.
...
> Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa koko
> kesäksi, ikävää että teikäläisiä ei kiinnosta.

Jotenkin jäi sellainen kuva, että osaat copypastata, mutta et ymmärrä
kopioimaasi tekstiä. Miksi kopioit tuon artikkelin?

Luin dynaamisen duon Leisola-Reinikainen toimittamaa kirjaa biologisesta
informaatiosta ja totesin kirjan kykenemättömäksi määrittelemään
itse kirjan aihetta. Törmäsivät siihen ainoaan ilmeiseen määritelmään
Shannonilaisesta informaatiosta, mutta koska se ei sovi kreationistiseen
maailmankuvaan, niin hylkäsivät sen. Sitten alkoi mussutus semantiikasta
ja merkityksistä.

Shannonin paperi on luettu jo opiskeluaiokina ja sen pohjalta tehty
sovelluksia entropiakoodausta käyttäen Huffman-puita rakentaen.
Lisäksi syntaksi ja semantiikka pitää selvittää kun toteutetaan
erilaisia käännettäviä lausekieliä (ohjelmointikieliä).

Eli kyllä tuo aihe kiinnostaa, mutta mistä sinä haluaisit keskustella.
Oletko samaa mieltä kuin John Maynard Smith tuossa artikkelissaan?
Siis hyväksytkö hänen näkemyksensä?
Voiko geneettistä informaatiota käsitellä Shannonilaisittain?

--
pam

TJT2

unread,
Jun 6, 2018, 4:03:27 AM6/6/18
to
Pekka Ala-Mäyry wrote:
> Sun, 03 Jun 2018 18:48:43 +0300, TJT2 kirjoitti:
>> Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa koko
>> kesäksi, ikävää että teikäläisiä ei kiinnosta.
>
> Jotenkin jäi sellainen kuva, että osaat copypastata, mutta et ymmärrä
> kopioimaasi tekstiä. Miksi kopioit tuon artikkelin?

Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko informaation
olemassaolon tai ainakin sen merkityksen. Hänellä kun on sellainen outo tapa
heitellä jotain lyhyitä, epämääräisiä huonolla suomella kirjoitettuja
tekstinpätkiä, sen asemesta että selittäisi kunnolla.

> Luin dynaamisen duon Leisola-Reinikainen toimittamaa kirjaa
> biologisesta informaatiosta ja totesin kirjan kykenemättömäksi
> määrittelemään itse kirjan aihetta.

Minä en ole lukenut kyseistä teosta, joten väitteesi jää nyt odottamaan sen
todenperäisyyden tarkistamista.

> Törmäsivät siihen ainoaan ilmeiseen määritelmään
> Shannonilaisesta informaatiosta, mutta koska se ei sovi
> kreationistiseen maailmankuvaan, niin hylkäsivät sen. Sitten alkoi
> mussutus semantiikasta ja merkityksistä.

Miten niin ainoaan? Sekä informaatiota yleensä että geneettistä
informaatiota voidaan määritelllä usealla eri tavalla (vertaa evoluution
määritelmien määrä) ja me kreationistit tietysti viittaamme prof.
Sanfordiin, joka kirjassaan selventää asiaa, joku voisi jopa sanoa että
esittää rankkaan kritiikkiä shannonilaisen informaatiokäsityksen
soveltamiseen biologiassa.

> Shannonin paperi on luettu jo opiskeluaiokina ja sen pohjalta tehty

Vaan oletko lukenut Sanfordin kirjan Genetic Entropy and The Mystery of the
Genome? Tai sen suomenkielisen version Eliömaailma rappeutuu?

> Eli kyllä tuo aihe kiinnostaa, mutta mistä sinä haluaisit keskustella.
> Oletko samaa mieltä kuin John Maynard Smith tuossa artikkelissaan?
> Siis hyväksytkö hänen näkemyksensä?

Hänellähän on tuossa paperissa useita näkemyksiä eri asioista, osan
hyväksyn, osaa en.

> Voiko geneettistä informaatiota käsitellä Shannonilaisittain?

Professori Sanfordin mukaan "potential information" ja "functional
information" ovat 2 eri asiaa.

--
--TJT--


Pekka Ala-Mäyry

unread,
Jun 6, 2018, 3:34:52 PM6/6/18
to
Wed, 06 Jun 2018 10:38:06 +0300, TJT2 kirjoitti:

> Pekka Ala-Mäyry wrote:
>> Sun, 03 Jun 2018 18:48:43 +0300, TJT2 kirjoitti:
>>> Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa koko
>>> kesäksi, ikävää että teikäläisiä ei kiinnosta.
>>
>> Jotenkin jäi sellainen kuva, että osaat copypastata, mutta et ymmärrä
>> kopioimaasi tekstiä. Miksi kopioit tuon artikkelin?
>
> Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko informaation
> olemassaolon tai ainakin sen merkityksen. Hänellä kun on sellainen outo tapa
> heitellä jotain lyhyitä, epämääräisiä huonolla suomella kirjoitettuja
> tekstinpätkiä, sen asemesta että selittäisi kunnolla.

Luulisin, että kyseessä on kvantitatiivisen informaation
määrä (ks. alla).

>> Luin dynaamisen duon Leisola-Reinikainen toimittamaa kirjaa
>> biologisesta informaatiosta ja totesin kirjan kykenemättömäksi
>> määrittelemään itse kirjan aihetta.
>
> Minä en ole lukenut kyseistä teosta, joten väitteesi jää nyt odottamaan sen
> todenperäisyyden tarkistamista.
>
>> Törmäsivät siihen ainoaan ilmeiseen määritelmään
>> Shannonilaisesta informaatiosta, mutta koska se ei sovi
>> kreationistiseen maailmankuvaan, niin hylkäsivät sen. Sitten alkoi
>> mussutus semantiikasta ja merkityksistä.
>
> Miten niin ainoaan? Sekä informaatiota yleensä että geneettistä
> informaatiota voidaan määritelllä usealla eri tavalla (vertaa evoluution
> määritelmien määrä) ja me kreationistit tietysti viittaamme prof.
> Sanfordiin, joka kirjassaan selventää asiaa, joku voisi jopa sanoa että
> esittää rankkaan kritiikkiä shannonilaisen informaatiokäsityksen
> soveltamiseen biologiassa.

Koska sinä teet väittämiä geneettisen informaation määrän muutoksista
(rappeutumistarinoittesi yhteydessä), niin tuo väite edellyttää
tietenkin geneettisen informaation kvantitatiivista mittaa.
Ainoa kvantitatiivinen mitta, joka on esitetty perustuu Shannonin
informaation määrään. Korjannet, jos olet käyttänyt väitteesi tukena
jotain muuta kvantitatiivista mittaria. Ilman yksikäsitteistä määrän
mittaria ei voi sanoa mitään määrän muutoksista (tai no tietenkin
kreationisti voi sanoa, mutta sen voi ohittaa käsien heilutteluna).

>> Shannonin paperi on luettu jo opiskeluaiokina ja sen pohjalta tehty
>
> Vaan oletko lukenut Sanfordin kirjan Genetic Entropy and The Mystery of the
> Genome? Tai sen suomenkielisen version Eliömaailma rappeutuu?

Koska sanoit: "Todella mielenkiintoinen paperi, josta riittäisi
keskusteltavaa koko kesäksi, ikävää että teikäläisiä ei kiinnosta.",
niin pysyn nyt vain tuossa John Maynard Smithin paperissa, sillä
minua se alkoi kiinnostamaan. Vai joko se kesä loppuikin jo?

>> Eli kyllä tuo aihe kiinnostaa, mutta mistä sinä haluaisit keskustella.
>> Oletko samaa mieltä kuin John Maynard Smith tuossa artikkelissaan?
>> Siis hyväksytkö hänen näkemyksensä?
>
> Hänellähän on tuossa paperissa useita näkemyksiä eri asioista, osan
> hyväksyn, osaa en.

Voisitko hieman avata tuota...
Perusteluiden kanssa - kiitos.

>> Voiko geneettistä informaatiota käsitellä Shannonilaisittain?
>
> Professori Sanfordin mukaan "potential information" ja "functional
> information" ovat 2 eri asiaa.

Taas copypastaat jotain lähdettä vastaamatta itse kysymykseen.
Etkö tajua tuosta mitään vai miksi et suostu vastaamaan.
Josko vaikka pysyisimme nyt tässä käsiteltävässä paperissa emmekä
pompi muihin tässä välillä.

--
pam

Raimo Suonio

unread,
Jun 6, 2018, 4:28:11 PM6/6/18
to
Itse Pekka Ala-Mäyry virkkoi, noin nimesi:

> Koska sinä teet väittämiä geneettisen informaation määrän
> muutoksista (rappeutumistarinoittesi yhteydessä), niin tuo väite
> edellyttää tietenkin geneettisen informaation kvantitatiivista
> mittaa. Ainoa kvantitatiivinen mitta, joka on esitetty perustuu
> Shannonin informaation määrään.

Ei ole ainoa. Toistakymmentä vuotta sitten hän vetosi Lee Spetneriin.
Spetner tosin käytti Shannonin suodatuskaavoja pohjanaan, mutta ei
Shannonin variaatiopohjaista informaation määrän laskua. Oheisesta
linkistä voit katsoa, mitä mieltä minä olin Spetnerin esityksestä:

<https://groups.google.com/forum/#!
msg/sfnet.keskustelu.evoluutio/bCqSvOAHL7s/AmqFqCCo5z4J>


> Ilman yksikäsitteistä määrän mittaria ei voi sanoa
> mitään määrän muutoksista (tai no tietenkin kreationisti voi
> sanoa, mutta sen voi ohittaa käsien heilutteluna).

Täsmälleen. Ja nythän Tarvonen tunnusti, ettei kreationisteilla ole
mitään menetelmää käytettävissään. Ei kai hän muuten olisi tässä
samassa ketjussa sanonut: "- - et mitään numeroarvoja antanutkaan, vaan
enhän minäkään ole antanut, eikä muut kreationistit". Siispä, aina kun
hän väittää, ettei "aidosti hyödyllisiä" eli informaatiota lisääviä
mutaatioita ole, hänen väitteensä on täysin pohjaa vailla ja voit
todellakin pitää sitä käsien heilutteluna.


--
Raimo Suonio, Hyvinkää, Finland
http://www.nic.fi/%7Ersuonio/
Oikeinkirjoitusohjeita news- ja web-kirjoittajille:
http://www.nic.fi/%7Ersuonio/oikeinkirjoitus/

---
This email has been checked for viruses by AVG.
https://www.avg.com

tapio linkosalo

unread,
Jun 7, 2018, 12:43:37 AM6/7/18
to
On 6/6/2018 22:34, Pekka Ala-Mäyry wrote:
> Koska sinä teet väittämiä geneettisen informaation määrän muutoksista
> (rappeutumistarinoittesi yhteydessä), niin tuo väite edellyttää
> tietenkin geneettisen informaation kvantitatiivista mittaa.
> Ainoa kvantitatiivinen mitta, joka on esitetty perustuu Shannonin
> informaation määrään. Korjannet, jos olet käyttänyt väitteesi tukena
> jotain muuta kvantitatiivista mittaria. Ilman yksikäsitteistä määrän
> mittaria ei voi sanoa mitään määrän muutoksista (tai no tietenkin
> kreationisti voi sanoa, mutta sen voi ohittaa käsien heilutteluna).

Tuossa otsikossa mainitussa artikkelissaan Smith viittaa Shannonin
informaatioteoriaan. Ja toteaa, että periaatteessa sen avulla voisi
laskea DNA:n informaatiomäärän, jos olettaisi että perättäiset
nukleotidit olisivat riippumattomia. Mitä ne todellisuudessa eivät ole.
Mutta toisaalta, kuten Smith toteaa, DNA:n toistot ja inaktiiviset
alueet osoittavat, ettei kaikkea tallennuskapasiteettia edes
tarvita/käytetä. Näin ollen Shannonin laskentakaavalla voi laskea arvion
DNA:n maksimaaliselle potentiaaliselle informaation
säilöntäkapasiteetille, mutta sen avulla ei voi mitata DNA:ssa
todellisuudessa olevan informaation määrää.




-Tapio-

TJT2

unread,
Jun 7, 2018, 3:39:46 AM6/7/18
to
Pekka Ala-Mäyry wrote:
> Wed, 06 Jun 2018 10:38:06 +0300, TJT2 kirjoitti:
>
>> Pekka Ala-Mäyry wrote:
>>> Sun, 03 Jun 2018 18:48:43 +0300, TJT2 kirjoitti:
>>>> Todella mielenkiintoinen paperi, josta riittäisi keskusteltavaa
>>>> koko kesäksi, ikävää että teikäläisiä ei kiinnosta.
>>>
>>> Jotenkin jäi sellainen kuva, että osaat copypastata, mutta et
>>> ymmärrä kopioimaasi tekstiä. Miksi kopioit tuon artikkelin?
>>
>> Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko
>> informaation olemassaolon tai ainakin sen merkityksen. Hänellä kun
>> on sellainen outo tapa heitellä jotain lyhyitä, epämääräisiä
>> huonolla suomella kirjoitettuja tekstinpätkiä, sen asemesta että
>> selittäisi kunnolla.
>
> Luulisin, että kyseessä on kvantitatiivisen informaation
> määrä (ks. alla).

Siitähän se stenberi höpisi, verrattuaan ensin ihmisen ja bakun infoja.
Oletko sinä samaa mieltä Kaj Stenberin kanssa
x x x clip x x x
Uskon että (yksi) ongelmasi on ettet oikeastaan ymmärrä eron
kvalitatiivisen (=onko) ja kvantitativisen (paljonko). Kukaan
ei ole kieltänyt etteikö genomissa olisi informaatiota. Kukaan
ei myöskään ole tietämätön siitä että ihmisgenomissa on enemmän
on enemmän informaatiota kuin bakteerisolussa.

Se huuhaa tulee siitä kun yrittää saada kvantitatiivisia lukuja ja
verrata ne keskenään. Ei mahdollista, useastakin syystä. (Huomasitko
muuten että tällä kertaa copypastatussa kohdassa 5 puhuttiin
informaation noususta?)
x x x clop x x x
Huomaa etenkin stenberin väite "Kukaan
ei myöskään ole tietämätön siitä että ihmisgenomissa on enemmän
on enemmän informaatiota kuin bakteerisolussa."
(kaksinkertainen "on enemmän" lienee typo)

>> Miten niin ainoaan? Sekä informaatiota yleensä että geneettistä
>> informaatiota voidaan määritelllä usealla eri tavalla (vertaa
>> evoluution määritelmien määrä) ja me kreationistit tietysti
>> viittaamme prof. Sanfordiin, joka kirjassaan selventää asiaa, joku
>> voisi jopa sanoa että esittää rankkaan kritiikkiä shannonilaisen
>> informaatiokäsityksen soveltamiseen biologiassa.
>
> Koska sinä teet väittämiä geneettisen informaation määrän muutoksista
> (rappeutumistarinoittesi yhteydessä), niin tuo väite edellyttää
> tietenkin geneettisen informaation kvantitatiivista mittaa.

Mihinkäs se hiekkakasa ja muut vertaukseni taas unohtuivat? Määrän muutos ei
edellytä tarkkaa mittaamista, sen sijaan Kaj Stenbergin suorittama vertailu
ihmisen ja bakteerin välillä edellyttää!

> Ainoa kvantitatiivinen mitta, joka on esitetty perustuu Shannonin
> informaation määrään. Korjannet, jos olet käyttänyt väitteesi tukena
> jotain muuta kvantitatiivista mittaria. Ilman yksikäsitteistä määrän
> mittaria ei voi sanoa mitään määrän muutoksista (tai no tietenkin
> kreationisti voi sanoa, mutta sen voi ohittaa käsien heilutteluna).

Ahaa, Kaj Stenberg on siis sinun mielestäsi kreationisti...


>>> Shannonin paperi on luettu jo opiskeluaiokina ja sen pohjalta tehty
>>
>> Vaan oletko lukenut Sanfordin kirjan Genetic Entropy and The Mystery
>> of the Genome? Tai sen suomenkielisen version Eliömaailma rappeutuu?
>
> Koska sanoit: "Todella mielenkiintoinen paperi, josta riittäisi
> keskusteltavaa koko kesäksi, ikävää että teikäläisiä ei kiinnosta.",
> niin pysyn nyt vain tuossa John Maynard Smithin paperissa, sillä
> minua se alkoi kiinnostamaan. Vai joko se kesä loppuikin jo?

Vesilätäköissä tänä aamuna olleen jääkerroksen paksuudesta päätellen näyttää
loppuneen.

>>> Eli kyllä tuo aihe kiinnostaa, mutta mistä sinä haluaisit
>>> keskustella. Oletko samaa mieltä kuin John Maynard Smith tuossa
>>> artikkelissaan? Siis hyväksytkö hänen näkemyksensä?
>>
>> Hänellähän on tuossa paperissa useita näkemyksiä eri asioista, osan
>> hyväksyn, osaa en.
>
> Voisitko hieman avata tuota...

Voisin, mutta kannattaako se jos sinun argumenttisi ovat tasoa "Ilman
yksikäsitteistä määrän mittaria ei voi sanoa mitään määrän muutoksista (tai
no tietenkin kreationisti voi sanoa, mutta sen voi ohittaa käsien
heilutteluna)."!?

> Perusteluiden kanssa - kiitos.

Johan minä copypastasin siitä monta kohtaa.

>>> Voiko geneettistä informaatiota käsitellä Shannonilaisittain?
>>
>> Professori Sanfordin mukaan "potential information" ja "functional
>> information" ovat 2 eri asiaa.
>
> Taas copypastaat jotain lähdettä vastaamatta itse kysymykseen.

Ahaa, et ymmärrä vastausta jos sitä ei väännä rautalangasta.

> Etkö tajua tuosta mitään vai miksi et suostu vastaamaan.
> Josko vaikka pysyisimme nyt tässä käsiteltävässä paperissa emmekä
> pompi muihin tässä välillä.

Paperia pitää tietysti käsitellä siinä kontekstissa, mitä tiedämme
informaatiosta nyt vuonna 2018, kai huomasit että John Smithin paperilla on
jo ikää? Siis eräs syy, miksi postasin nimenomaan tuon paperin, oli se että
sillä on historiallista mielenkiintoa, geneettisen informaation olemassaolo
myönnetty johtavien evotiedemiesten toimesta jo 1900-luvulla.

--
--TJT--

Kaj Stenberg

unread,
Jun 7, 2018, 5:12:01 AM6/7/18
to
Den onsdag 6 juni 2018 kl. 11:03:27 UTC+3 skrev TJT2:

> Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko informaation
> olemassaolon tai ainakin sen merkityksen.

Usein kun lukee noita Tarvosen "johtopäätöksiä" herää kyllä mieleen
onko kyseessä rehellisesti kyvyttömyys ymmärtää vaiko tietoinen
vääristely ja valehtelu.

> Hänellä kun on sellainen outo tapa
> heitellä jotain lyhyitä, epämääräisiä huonolla suomella kirjoitettuja
> tekstinpätkiä, sen asemesta että selittäisi kunnolla.

Joo, minulle on jo kauan sitten osoitettu/opetettu että kannattaa
keskittyä johonkin olennaiseen ja kommentoida ytimekkäästi. Ylipitkät
lainaukset ja rönsyilevä tajunnanvirta kertoo eniten kirjoittajasta.

Niin kauan kun tasosi biologiassa on mitä ymmärrät lukion kirjoista ei
ole _mitään_ saumaa osoittaa onnistuneesti sinulle evoluution "olemusta".

He who would learn to fly one day must first learn to stand and walk
and run and climb and dance; one cannot fly into flying.
-Friedrich Nietzsche

--
Kaj





Kaj Stenberg

unread,
Jun 7, 2018, 5:14:47 AM6/7/18
to
Den onsdag 6 juni 2018 kl. 22:34:52 UTC+3 skrev Pekka Ala-Mäyry:
> Wed, 06 Jun 2018 10:38:06 +0300, TJT2 kirjoitti:

> > Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko informaation
> > olemassaolon tai ainakin sen merkityksen. Hänellä kun on sellainen outo tapa
> > heitellä jotain lyhyitä, epämääräisiä huonolla suomella kirjoitettuja
> > tekstinpätkiä, sen asemesta että selittäisi kunnolla.
>
> Luulisin, että kyseessä on kvantitatiivisen informaation
> määrä (ks. alla).

Kirjoitusten perusteella näyttäisi aika selvältä ettei Tarvonen
(edelleenkään) ymmärrä eroa kvantitatiivisen ja kvalitatiivisen välillä

--
Kaj

Kaj Stenberg

unread,
Jun 7, 2018, 5:26:30 AM6/7/18
to
Den torsdag 7 juni 2018 kl. 10:39:46 UTC+3 skrev TJT2:
> Pekka Ala-Mäyry wrote:

> > Luulisin, että kyseessä on kvantitatiivisen informaation
> > määrä (ks. alla).
>
> Siitähän se stenberi höpisi, verrattuaan ensin ihmisen ja bakun infoja.
> Oletko sinä samaa mieltä Kaj Stenberin kanssa
> x x x clip x x x
> Uskon että (yksi) ongelmasi on ettet oikeastaan ymmärrä eron
> kvalitatiivisen (=onko) ja kvantitativisen (paljonko). Kukaan
> ei ole kieltänyt etteikö genomissa olisi informaatiota. Kukaan
> ei myöskään ole tietämätön siitä että ihmisgenomissa on enemmän
> on enemmän informaatiota kuin bakteerisolussa.

Siis Tarvoselle on täysin ylivoimaista ymmärtää että vaikka ääripäitä
voi erottaa toisistaan siinä välissä olevassa laajassa "maastossa" ei
voida merkityksellisesti "mitata" suht pieniä muutoksia? Vai oliko
se tämä täysin kammottava virhe 2 x "on enemmän" joka johti siihen
että Tarvonen ei ymmärtänyt koko asiasta mitään?

--
Kaj

Kaj Stenberg

unread,
Jun 7, 2018, 6:36:59 AM6/7/18
to
Den onsdag 6 juni 2018 kl. 22:34:52 UTC+3 skrev Pekka Ala-Mäyry:

> Koska sinä teet väittämiä geneettisen informaation määrän muutoksista
> (rappeutumistarinoittesi yhteydessä), niin tuo väite edellyttää
> tietenkin geneettisen informaation kvantitatiivista mittaa.
> Ainoa kvantitatiivinen mitta, joka on esitetty perustuu Shannonin
> informaation määrään.

Minua aina häiritsee kun DNAta käsitellään ikään kun sitä olisi (informaatiomielessä) kahdenlaista, koodaavaa ja ei-koodaavaa, ja
muulla ei ole väliä.

(Hyppään valtavasti). Tarkastellaan erittäin pelkistettyä tapausta:
yksi geeni, joka koodaa yhtä proteiinia, olkoon nyt entsyymi.
Tarkastellaan _vain_ tapausta missä yksi nukleotidimuutos
välittömästi muuttaa yhden aminohapon. Nyt on mahdollisuudet

1) Proteinin kolmiulotteisessa rakenteessa ko aminohappo sijaitsee
pinnalla. Muutos tuskin aiheuttaa mitään toiminnallista häiriöitä
(poikkeus: esim sirppisoluanemia)

2) Muutos on proteinin sisällä. Jos muutos on iso sivuketju -> pieni
sivuketju tuskin merkitystä. Jos toisin päin taikka vaikkapa
sähkövaraukset muuttuvat vaikuttanee stabilisuuteen. Akselilla
mitättömän vähän - katastrofaalisesti

3) Aktiivisessa pinnassa. Jos vaikkapa a) His taikka Tyr "muuttuu"
entsyymi luultavasti menettää toimintansa, ovat hyvin yleisiä "reaktioaminohappoja". Jos taas b) aktiivisessa pinnassa muu aminohappo
hyvinkin mahdollista että entsyymi saa uuden substraattispesifisyyden
(=uusi funktio).

1-3 siis kaikki yhden nukleotidimuutoksen mahdollisia seurauksia. Miten
siis pelkästä DNAsta voisi mitään sanoa nukleotidimuutoksen "informaatioarvosta"?

--
Kaj

Pekka de Groot

unread,
Jun 7, 2018, 12:03:28 PM6/7/18
to
On 2018-06-07 09:12:00 +0000, Kaj Stenberg said:

> Den onsdag 6 juni 2018 kl. 11:03:27 UTC+3 skrev TJT2:
>
>> Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko informaation>
>> olemassaolon tai ainakin sen merkityksen.
> Usein kun lukee noita Tarvosen "johtopäätöksiä" herää kyllä mieleenonko
> kyseessä rehellisesti kyvyttömyys ymmärtää vaiko tietoinenvääristely ja
> valehtelu.

Eiköhän vastaus ole tuo jälkimmäinen. Ei hän muuten niin tehokkaasti
keskittyisi välttelemään tai vääristelemään juuri niitä osia
keskustelussa, jotka paljastaisivat kreationistien väitteiden lepäävän
tukevasti tyhjän päällä. IMHO hänen vastauksensa Ala-Mäyrylle osoittaa
asian harvinaisen selvästi. Hän mieluummin lyö leikiksi ja aloittaa
solvaamisen kuin selittää käsitteitä, esim. tässä: "Pekka Ala-Mäyry:
Taas copypastaat jotain lähdettä vastaamatta itse kysymykseen. TJT2:
Ahaa, et ymmärrä vastausta jos sitä ei väännä rautalangasta". Sitten
hän jättää vastaamatta, vaikka hänelle jälleen tarjotaan tilaisuutta
selittää informaatiokäsitettä, joka on kreationistien väitteiden
taustalla.

Se kertoo minusta sekä epävarmuudesta ja tietoisesta välttelystä. Sama
näkyy vastauksissa sinulle, mutta minusta selvemmin vastauksessa
kaimalle. Eihän TJT2 tyhmä ole. Pahansuopa, narsistinen ja
harhaanjohdettu (muitakin adjektiiveja tulee mieleen, mutta olkoon...),
mutta ei tyhmä sanan varsinaisessa merkityksessä.

Sama homma holokaustin kohdalla. Hän välttelee tarkennuksia
kysymyksiin, laajoja kokonaisuuksia ja hänen copy-paste -väitteensä
ovat todistusaineiston vääristelyä ja suoranaista valehtelua sekä
suoria lainauksia hänen auktoriteeteiltaan. Selvennyksiä väitteisiin ei
kovin usein tule. Hän ei siis esimerkiksi kirjoita auktoriteetin
väitteitä auki. Nähdäkseni se taas johtuu siitä, että hän on epävarma
siitä tunteeko joku vastaväittelijä asioita paremmin ja/tai siitä, että
hän luottaa sokeasti auktoriteetteihin.

Koska väitteet ja todisteet keskustelussa ovat usein samoja (mm. siksi,
ettei niitä ole kumottu), hän löytää vastaväitteet tahoilta, jotka ovat
hänelle auktoriteetteja. Hän innostui kovasti Mattognosta denialismin
puolella, koska Mattogno tarjoaa näennäisesti uskottavammat perusteet
denialistien pöllöilylle kuin hänen entiset auktoriteettinsa. Se kertoo
minusta siitä, että hän ymmärtää kyllä hyvin kuinka heikolla pohjalla
hänen identiteettinsä tieteelliset perustelut ovat. Sieltä kumpuaa
luultavasti myös aggressiivinen suhtautuminen keskustelussa. Sieltä ja
turhautumisesta, kun kukaan ei tunnu hyväksyvän hänen väitteitään.

Cheers,
Pekka de G.

Pekka Ala-Mäyry

unread,
Jun 7, 2018, 1:48:26 PM6/7/18
to
Thu, 07 Jun 2018 10:39:41 +0300, TJT2 kirjoitti:

> Pekka Ala-Mäyry wrote:
>> Wed, 06 Jun 2018 10:38:06 +0300, TJT2 kirjoitti:
>>
>>> Pekka Ala-Mäyry wrote:
>>>> Sun, 03 Jun 2018 18:48:43 +0300, TJT2 kirjoitti:

> Määrän muutos ei edellytä tarkkaa mittaamista...

Onko tuossa "tarkka" kreationistinen takaportti?

>>>> Eli kyllä tuo aihe kiinnostaa, mutta mistä sinä haluaisit
>>>> keskustella. Oletko samaa mieltä kuin John Maynard Smith tuossa
>>>> artikkelissaan? Siis hyväksytkö hänen näkemyksensä?
>>>
>>> Hänellähän on tuossa paperissa useita näkemyksiä eri asioista, osan
>>> hyväksyn, osaa en.
>>
>> Voisitko hieman avata tuota...
>
> Voisin, mutta kannattaako se jos sinun argumenttisi ovat tasoa "Ilman
> yksikäsitteistä määrän mittaria ei voi sanoa mitään määrän muutoksista (tai
> no tietenkin kreationisti voi sanoa, mutta sen voi ohittaa käsien
> heilutteluna)."!?

Olen edelleen tuota mieltä. Etkö osaa vai halua kertoa
näkemyksiäsi ilman, että kopioit tekstiä.

>
>> Perusteluiden kanssa - kiitos.
>
> Johan minä copypastasin siitä monta kohtaa.

Et koskaan sanonut mitä kohtaa niistä et hyväksynyt.

>>>> Voiko geneettistä informaatiota käsitellä Shannonilaisittain?
>>>
>>> Professori Sanfordin mukaan "potential information" ja "functional
>>> information" ovat 2 eri asiaa.
>>
>> Taas copypastaat jotain lähdettä vastaamatta itse kysymykseen.
>
> Ahaa, et ymmärrä vastausta jos sitä ei väännä rautalangasta.

Et vaan osaa...


>> Etkö tajua tuosta mitään vai miksi et suostu vastaamaan.
>> Josko vaikka pysyisimme nyt tässä käsiteltävässä paperissa emmekä
>> pompi muihin tässä välillä.
>
> Paperia pitää tietysti käsitellä siinä kontekstissa, mitä tiedämme
> informaatiosta nyt vuonna 2018, kai huomasit että John Smithin paperilla on
> jo ikää? Siis eräs syy, miksi postasin nimenomaan tuon paperin, oli se että
> sillä on historiallista mielenkiintoa, geneettisen informaation olemassaolo
> myönnetty johtavien evotiedemiesten toimesta jo 1900-luvulla.

Kuka on kieltänyt geneettisen informaation olemassaolon?
Taidat nyt pieksää olkiukkoa tässä asiassa.
Helpotan nyt sen verran, että hyväksyn tähän tuon vastauksen
copypastellakin.

--
pam

John Smith

unread,
Jun 7, 2018, 2:09:17 PM6/7/18
to
Tää nyt EI ole varaventtiiliasiaa, joten suksipa vittuun asiaryhmästä.

--
uʍop ǝpᴉs sᴉɥʇ

Pekka Ala-Mäyry

unread,
Jun 7, 2018, 3:48:37 PM6/7/18
to
Thu, 07 Jun 2018 21:09:17 +0300, John Smith kirjoitti:

> Pekka Ala-Mäyry wrote:
...
>> Kuka on kieltänyt geneettisen informaation olemassaolon?
>> Taidat nyt pieksää olkiukkoa tässä asiassa.
>> Helpotan nyt sen verran, että hyväksyn tähän tuon vastauksen
>> copypastellakin.
>>
> Tää nyt EI ole varaventtiiliasiaa, joten suksipa vittuun asiaryhmästä.

Sorry! Enpä huomannut, että säie meni myös varaventtiiliin.
Arvaan että tämä on Tarvosen tahallista ärsytystä, joka tuntuu toimivan.

--
pam

John Smith

unread,
Jun 7, 2018, 4:00:05 PM6/7/18
to
Sehän nyt ei edes tiedä, mitä kirjoittaa, saati minne olis asiallista
postata jätteensä.

--
uʍop ǝpᴉs sᴉɥʇ

Kaj Stenberg

unread,
Jun 8, 2018, 4:40:30 AM6/8/18
to
Den torsdag 7 juni 2018 kl. 19:03:28 UTC+3 skrev Pekka de Groot:

> Se kertoo minusta sekä epävarmuudesta ja tietoisesta välttelystä. Sama
> näkyy vastauksissa sinulle, mutta minusta selvemmin vastauksessa
> kaimalle. Eihän TJT2 tyhmä ole. Pahansuopa, narsistinen ja
> harhaanjohdettu (muitakin adjektiiveja tulee mieleen, mutta olkoon...),
> mutta ei tyhmä sanan varsinaisessa merkityksessä.

Kyllä minusta se ettei ymmärrä että samaa ilmiötä voi esittää eri
sanoilla taikka että samalla sanalla voi olla eri merkityksiä
osoittaa eräänlaista tyhmyyttä. En usko että se on feikkiä. Lukee
ilmeisesti paljon joo, mutta ei taida koskaan pysähtyä miettimään
sanojen merkitystä sitä mekaanisen sanavertailua syvemmälle.

Toki, osittain voisi selittyä koulutuksen puutteella ja "oikeiden"
auktoriteettien sokeaan uskomiseen (se että etsii "vihollisia" joka
käänteessä liittynee muuhun).

--
Kaj

TJT2

unread,
Jun 8, 2018, 5:04:22 AM6/8/18
to
Pekka Ala-Mäyry wrote:
> Thu, 07 Jun 2018 10:39:41 +0300, TJT2 kirjoitti:
>> Määrän muutos ei edellytä tarkkaa mittaamista...
>
> Onko tuossa "tarkka" kreationistinen takaportti?

En ymmärrä kysymystä.

>> Voisin, mutta kannattaako se jos sinun argumenttisi ovat tasoa "Ilman
>> yksikäsitteistä määrän mittaria ei voi sanoa mitään määrän
>> muutoksista (tai no tietenkin kreationisti voi sanoa, mutta sen voi
>> ohittaa käsien heilutteluna)."!?
>
> Olen edelleen tuota mieltä. Etkö osaa vai halua kertoa
> näkemyksiäsi ilman, että kopioit tekstiä.

Kaj Stenberg ei edelleenkään ole kreationisti, ja olen ihan selvästi
esittänyt näkemykseni että nimenomaan määrän MUUTOSTA voidaan havainnoida
ilman tarkkaa lukuarvoa, siis sen tarkan arvon mittaamista, ja olen
esittänyt useita kertoja mm. hiekkakasavertauksen. Olen myös kertonut
näkemykseni, että John M. Smith on tyhmä kun ei näe sitä toista vaihtoehtoa
infon alkuperälle, vaan yrittää epätoivoisesti selittää sitä ateistisessa
kontekstissa.

>>> Perusteluiden kanssa - kiitos.
>>
>> Johan minä copypastasin siitä monta kohtaa.
>
> Et koskaan sanonut mitä kohtaa niistä et hyväksynyt.

Miksi valehtelet? Ihan selvästi kirjoitit Smithin kyvyttömyydestä
x x x
Tottakai huomaan mitä itse copypastaan. Ateisiten evotiedemies yrittää
selittää informaation alkuperää ateistisessa kontekstissa, kun ei kykene
näkemään mitään muuta vaihtoehtoa (myöntää suoraan toisen kappaleen
viimeisssä lauseessa, joten copypastaan vitoskohdan 2 ekaa kappaletta)
x x x
ja ihan selvästi olen sanonut, että hyväksyn hänen näkemyksensä, että
geneettinen informaatio on olemassa, ja hänellähän jopa oli jotain yritystä
sen laskemiseksi/mittaamiseksi.

>>>>> Voiko geneettistä informaatiota käsitellä Shannonilaisittain?
>>>>
>>>> Professori Sanfordin mukaan "potential information" ja "functional
>>>> information" ovat 2 eri asiaa.
>>>
>>> Taas copypastaat jotain lähdettä vastaamatta itse kysymykseen.
>>
>> Ahaa, et ymmärrä vastausta jos sitä ei väännä rautalangasta.
>
> Et vaan osaa...

selittää niin että sinäkin ymmärtäisit että onko vastaust "ei" vai "kyllä".
Sinä esitit kysymyksen, joka periaatteessa on "kyllä vai ei" kysymys, johon
minä ystävällisenä ja asiallisena keskustelija vastasin kirjoittamalla ne
vastauksen perustelut itse vastaukseen. Siis jos Sanfordin mukaan nuo 2
infoa ovat eri asioista, niin pitäisi sinunkin tajuta, että vastaus on "ei".
Varsinkin kun vielä lisäsin, että Sanford esittänyt kritiikkiä... joten
ilmeisesti sinulle vastaaminen edellyttää jotain JPK:n aka JiiPeen tasolle
vajoamista, johon minä en taida kyetä.

>>> Etkö tajua tuosta mitään vai miksi et suostu vastaamaan.
>>> Josko vaikka pysyisimme nyt tässä käsiteltävässä paperissa emmekä
>>> pompi muihin tässä välillä.
>>
>> Paperia pitää tietysti käsitellä siinä kontekstissa, mitä tiedämme
>> informaatiosta nyt vuonna 2018, kai huomasit että John Smithin
>> paperilla on jo ikää? Siis eräs syy, miksi postasin nimenomaan tuon
>> paperin, oli se että sillä on historiallista mielenkiintoa,
>> geneettisen informaation olemassaolo myönnetty johtavien
>> evotiedemiesten toimesta jo 1900-luvulla.
>
> Kuka on kieltänyt geneettisen informaation olemassaolon?

Joku evolutionisti. Saattoi olla sama, joka kiisti pehmytkudosten yms
teikäläisille kiusallaisen tavaran löytymisen saurusten "fossiileista." Ja
joku kiistäjä jopa teki minusta rikosilmoituksen poliisille, "jostain"
syystä poliisi ei ottanut hänen ilmoitustaan vastaan. Viimeksikuluneiden 25
vuoden aikana tullut vastaan eri foorumeilla niin monta evolutionistia ja
niin outoja väitteitä, että en mitenkään voi muistaa niitä kaikkia, ainakaan
tarkkaan. Mutta joitakin "helmiä" on jäänyt muistiin, esim se kun
evotoverisi SeppoPönttö väitti, että magneettikentällä ei ole energiaa,
joten mitään heikkenemisongelmaa ei oikeasti voi olla olemassa!

> Taidat nyt pieksää olkiukkoa tässä asiassa.
> Helpotan nyt sen verran, että hyväksyn tähän tuon vastauksen
> copypastellakin.

Eikös meidän pidäkään pysyä käsiteltävässä paperissa? Ei siellä
evotovereittesi nimiä eikä nimimerkkejä mainita...

--
--TJT--


TJT2

unread,
Jun 8, 2018, 5:04:22 AM6/8/18
to
Kaj Stenberg wrote:
> Den torsdag 7 juni 2018 kl. 10:39:46 UTC+3 skrev TJT2:
>> Siitähän se stenberi höpisi, verrattuaan ensin ihmisen ja bakun
>> infoja. Oletko sinä samaa mieltä Kaj Stenberin kanssa
>> x x x clip x x x
>> Uskon että (yksi) ongelmasi on ettet oikeastaan ymmärrä eron
>> kvalitatiivisen (=onko) ja kvantitativisen (paljonko). Kukaan
>> ei ole kieltänyt etteikö genomissa olisi informaatiota. Kukaan
>> ei myöskään ole tietämätön siitä että ihmisgenomissa on enemmän
>> on enemmän informaatiota kuin bakteerisolussa.
>
> Siis Tarvoselle on täysin ylivoimaista ymmärtää että vaikka ääripäitä

Ahaa, bakteeri on siis sinun mielestäsi jokin ääripää? Et ole koskaan
kuullut, että bakteereja on erilaisia? Et ymmärrä, että sinulla on tuo
vertauksesi pielessä jo tuosta lähtien, vertaat laajaa eliöryhmää
yksittäiseen lajiin.

> voi erottaa toisistaan siinä välissä olevassa laajassa "maastossa" ei
> voida merkityksellisesti "mitata" suht pieniä muutoksia? Vai oliko

Vaan ethän sinä puhunut mitään mistään muutoksista, vaan vertasit jonkin
mystisen nykyisen bakteerin infoa ihmislajin infoon.

> se tämä täysin kammottava virhe 2 x "on enemmän" joka johti siihen
> että Tarvonen ei ymmärtänyt koko asiasta mitään?

Sanoo stenberi, joka ei ymmärrä verrata yksittäistä lajia toiseen
yksittäiseen lajiin, ja jokoa ei ymmärrä mitä eroa on saman lajin
muutoksissa ajan funktiona verrattuna kahden saman aikaan elävän eri eliön
vertailuun. Kykenetkö sinä, Kaj Stebnerg, tekemään mitään muuta näissä
keskusteluissa kuin esittämään idioottimaisia spekulaatioita mitä joku
Tarvonen ymmärtää ja mitä ei? Joko muuten olet lukenut
https://trueorigin.org/mutations01.asp ?

--
--TJT--
Kaksi samantapaista mutta ei samanlaista määritelmää antaa kuvan siitä, että
asiaa ei todella itsekään ymmärretä.
- evolutionisti Raimo Suonio


Kaj Stenberg

unread,
Jun 8, 2018, 5:22:42 AM6/8/18
to
Den fredag 8 juni 2018 kl. 12:04:22 UTC+3 skrev TJT2:

> Ahaa, bakteeri on siis sinun mielestäsi jokin ääripää? Et ole koskaan
> kuullut, että bakteereja on erilaisia? Et ymmärrä, että sinulla on tuo
> vertauksesi pielessä jo tuosta lähtien, vertaat laajaa eliöryhmää
> yksittäiseen lajiin.

Mikrobiologia on yksi pääaineeni joten enköhän tiedä. Tiedän myös että
pitää olla äärettömän rajoittunut ja jähmettynyt putkiaivo jos jää
roikkumaan tuohon sanaan "ääripää".

> Vaan ethän sinä puhunut mitään mistään muutoksista, vaan vertasit
> jonkin mystisen nykyisen bakteerin infoa ihmislajin infoon.

Juuri näin, onnitteluni! nykybakullla on vähemmän infoa solussa
kun nykyihmisellä, mutta kummallekaan ei voi antaa (järkevää)
numeerista arvoa.

--
Kaj

Kaj Stenberg

unread,
Jun 8, 2018, 6:24:44 AM6/8/18
to
Den fredag 8 juni 2018 kl. 12:04:22 UTC+3 skrev TJT2:
> Kykenetkö sinä, Kaj Stebnerg, tekemään mitään muuta näissä
> keskusteluissa kuin esittämään idioottimaisia spekulaatioita mitä joku
> Tarvonen ymmärtää ja mitä ei?

Mitä se sinua liikuttaa mitä spekuloin jostain Tarvosesta, ethän
sinä edes häntä tunne?

--
Kaj

Pekka de Groot

unread,
Jun 8, 2018, 6:32:24 AM6/8/18
to
On 2018-06-08 08:40:29 +0000, Kaj Stenberg said:

> Den torsdag 7 juni 2018 kl. 19:03:28 UTC+3 skrev Pekka de Groot:
>> Se kertoo minusta sekä epävarmuudesta ja tietoisesta välttelystä. Sama>
>> näkyy vastauksissa sinulle, mutta minusta selvemmin vastauksessa>
>> kaimalle. Eihän TJT2 tyhmä ole. Pahansuopa, narsistinen ja>
>> harhaanjohdettu (muitakin adjektiiveja tulee mieleen, mutta
>> olkoon...),> mutta ei tyhmä sanan varsinaisessa merkityksessä.
>
> Kyllä minusta se ettei ymmärrä että samaa ilmiötä voi esittää
> erisanoilla taikka että samalla sanalla voi olla eri
> merkityksiäosoittaa eräänlaista tyhmyyttä. En usko että se on feikkiä.
> Lukeeilmeisesti paljon joo, mutta ei taida koskaan pysähtyä
> miettimäänsanojen merkitystä sitä mekaanisen sanavertailua syvemmälle.
> Toki, osittain voisi selittyä koulutuksen puutteella ja
> "oikeiden"auktoriteettien sokeaan uskomiseen (se että etsii
> "vihollisia" jokakäänteessä liittynee muuhun).

Minun tulkintani mukaan useimmiten niissä tapauksissa kyse on siitä,
että TJT2 ymmärtää kyllä ongelman, mutta koska hän joutuisi myöntämään
jotain l. hänen näkemyksensä ei olisi enää sen jälkeen
puolusteltavissa, hän ei voi antaa periksi. Se taas kävisi hyvin
nopeasti kohtalokkaaksi hänen ideologiansa suhteen. Sen vuoksi hän
reagoi esittämällä tyhmää (= ei muka ymmärrä) tai aloittaa solvaamisen
tai johtaa keskustelun sivuraiteelle.

Tämä nyt on kyllä puhtaasti vain minun spekulaatiotani. Minusta se on
pahempi juttu kuin puhdas kyvyttömyys olla ymmärtämättä asioita.

Cheers,
Pekka de G.

Pekka Ala-Mäyry

unread,
Jun 8, 2018, 3:15:00 PM6/8/18
to
Fri, 08 Jun 2018 12:03:21 +0300, TJT2 kirjoitti:

> Pekka Ala-Mäyry wrote:
>> Thu, 07 Jun 2018 10:39:41 +0300, TJT2 kirjoitti:
>>> Määrän muutos ei edellytä tarkkaa mittaamista...
>>
>> Onko tuossa "tarkka" kreationistinen takaportti?
>
> En ymmärrä kysymystä.

Kun aina tartut lillukanvarsiin, niin mitä tarkoitat tuossa
sanalla "tarkka"? Takaportti on toki yleensä JPK:n tahallisia
ilmaisuja, joita käyttäen voi näppärästi kiistää
mitä tuli sanotuksi.

Määrän muutoksen mittaaminen edellyttää, että on jokin
yksikäsitteinen mitta, jonka perusteella mittaustulokset voidaan
järjestää suuruusjärjestykseen. Mikä on tämä biologisen
informaation mitta?

>>> Voisin, mutta kannattaako se jos sinun argumenttisi ovat tasoa "Ilman
>>> yksikäsitteistä määrän mittaria ei voi sanoa mitään määrän
>>> muutoksista (tai no tietenkin kreationisti voi sanoa, mutta sen voi
>>> ohittaa käsien heilutteluna)."!?
>>
>> Olen edelleen tuota mieltä. Etkö osaa vai halua kertoa
>> näkemyksiäsi ilman, että kopioit tekstiä.
>
>... olen ihan selvästi esittänyt näkemykseni että nimenomaan
> määrän MUUTOSTA voidaan havainnoida ilman tarkkaa lukuarvoa,
> siis sen tarkan arvon mittaamista
Mutta myös tuossa tapauksessa biologisella informaatiolla pitää
olla jokin määritelmä, että voidaan sanoa onko määrä kasvanut
vai vähentynyt. Mikä on tuo määritelmä?

Eräskin tarvonen on piirrellyt käppyröitään nettisivulleen
http://personal.inet.fi/koti/tjt/evvaikea.html

ja väittää jotain biologisen informaation määrästä. Minä ilmaisin
mielipiteeni siitä, että noita käyriä ei voi piirrellä elleivät
ne perustu johonkin määritelmään ja sen pohjalta tehtyyn mittaukseen.
Vetäisit kuvainnollisesti erään palkokasvin osan nenäonteloon
johtavaan aukkoon käyttämästäni ilmaisusta (jota muuten käytetään
akateemisesti ilmaisemaan todistamattomia väitteitä ja todistuksessa
tehtyjä hyppäyksiä). https://en.wikipedia.org/wiki/Hand-waving

> ... Olen myös kertonut näkemykseni, että John M. Smith on
> tyhmä kun ei näe sitä toista vaihtoehtoa infon alkuperälle,
> vaan yrittää epätoivoisesti selittää sitä ateistisessa
> kontekstissa.

Ai niin se idea, että jokin kaikkivaltias toimija olisi
suunnitellut ne geenit sinne valmiina?

Tieteellinen ajatusmalli ei voi tietenkään käyttää tuollaista
deus ex machina juonenkäänteitä. Ei ole olemassa mitään syytä
olettaa että GDI.

Onko mielestäsi on tyhmyyttä olla ottamatta GDI:tä huomioon
tieteellisen teorian perusteissa?

...
>>>>>> Voiko geneettistä informaatiota käsitellä Shannonilaisittain?
>>>>>
>>>>> Professori Sanfordin mukaan "potential information" ja "functional
>>>>> information" ovat 2 eri asiaa.
>>>>
>>>> Taas copypastaat jotain lähdettä vastaamatta itse kysymykseen.
>>>
>>> Ahaa, et ymmärrä vastausta jos sitä ei väännä rautalangasta.
>>
>> Et vaan osaa...
>
> selittää niin että sinäkin ymmärtäisit että onko vastaust "ei" vai "kyllä".
> Sinä esitit kysymyksen, joka periaatteessa on "kyllä vai ei" kysymys, johon
> minä ystävällisenä ja asiallisena keskustelija vastasin kirjoittamalla ne
> vastauksen perustelut itse vastaukseen. Siis jos Sanfordin mukaan nuo 2
> infoa ovat eri asioista, niin pitäisi sinunkin tajuta, että vastaus on "ei".
> Varsinkin kun vielä lisäsin, että Sanford esittänyt kritiikkiä... joten
> ilmeisesti sinulle vastaaminen edellyttää jotain JPK:n aka JiiPeen tasolle
> vajoamista, johon minä en taida kyetä.

Eli Shannonilaisittain ei voida mitata biologisen informaation määrää
kvantitatiivisesti. Shannonin teoria antaa kuitenkin jonkinlaisen
ylärajan geenien informaatiolle. Onko olemassa mitään muuta tapaa
mitata tuon biologisen informaation määrää kvantitatiivisesti?
Ellei ole, niin kaikkia näitä kreationistiväitteitä voidaan kuvata
sillä yllämainitulla akateemisella ilmaisulla. Jos taas tuollainen
määrittely/mittaustapa kreationisteilta löytyy, niin päästä meidät
jännityksestä ja kerro jo mikä se on.

>>>> Etkö tajua tuosta mitään vai miksi et suostu vastaamaan.
>>>> Josko vaikka pysyisimme nyt tässä käsiteltävässä paperissa emmekä
>>>> pompi muihin tässä välillä.
>>>
>>> Paperia pitää tietysti käsitellä siinä kontekstissa, mitä tiedämme
>>> informaatiosta nyt vuonna 2018, kai huomasit että John Smithin
>>> paperilla on jo ikää? Siis eräs syy, miksi postasin nimenomaan tuon
>>> paperin, oli se että sillä on historiallista mielenkiintoa,
>>> geneettisen informaation olemassaolo myönnetty johtavien
>>> evotiedemiesten toimesta jo 1900-luvulla.
>>
>> Kuka on kieltänyt geneettisen informaation olemassaolon?
>
> Joku evolutionisti.

Niin varmaan. Ei ainakaan kreationisti.

--
pam

Raimo Suonio

unread,
Jun 9, 2018, 5:40:56 AM6/9/18
to
Itse Kaj Stenberg virkkoi, noin nimesi:

> Mikrobiologia on yksi pääaineeni joten enköhän tiedä. Tiedän
> myös että pitää olla äärettömän rajoittunut ja
> jähmettynyt putkiaivo jos jää roikkumaan tuohon sanaan
> "ääripää".

Tarvosen perustaktiikka on peittää tietämättömyytensä ja
ymmärtämättömyytensä pilkun naimiseen. Keskustelisit ennemmin vaikka
Juha-Pekan kanssa - saisit älyllisempiä vastauksia.

TJT2

unread,
Jun 11, 2018, 4:55:10 AM6/11/18
to
Raimo Suonio wrote:
> Itse Kaj Stenberg virkkoi, noin nimesi:
>
>> Mikrobiologia on yksi pääaineeni joten enköhän tiedä. Tiedän
>> myös että pitää olla äärettömän rajoittunut ja
>> jähmettynyt putkiaivo jos jää roikkumaan tuohon sanaan
>> "ääripää".
>
> Tarvosen perustaktiikka on peittää tietämättömyytensä ja
> ymmärtämättömyytensä pilkun naimiseen. Keskustelisit ennemmin vaikka
> Juha-Pekan kanssa - saisit älyllisempiä vastauksia.

ROTFLMAO!!! Ja koska sivustoni näyttää olevan edelleenkin olemassa, ihan
kertauksen vuoksi
http://personal.inet.fi/koti/tjt/evkummars.html
ja
http://personal.inet.fi/koti/tjt/evkummasfnet.html
ja
http://personal.inet.fi/koti/tjt/evkummaskep.html
ja
http://personal.inet.fi/koti/tjt/evcoynemain.html

--
--TJT--
Juha-Pekka on, antakaa anteeksi suorasukaisuuteni, ällöttävä paska!
- Raimo "asiallinen keskustelija" Suonio, 6.3.2012, s.k.evoluutio


TJT2

unread,
Jun 11, 2018, 4:55:10 AM6/11/18
to
Kaj Stenberg wrote:
> Den fredag 8 juni 2018 kl. 12:04:22 UTC+3 skrev TJT2:
>
>> Ahaa, bakteeri on siis sinun mielestäsi jokin ääripää? Et ole koskaan
>> kuullut, että bakteereja on erilaisia? Et ymmärrä, että sinulla on
>> tuo vertauksesi pielessä jo tuosta lähtien, vertaat laajaa eliöryhmää
>> yksittäiseen lajiin.
>
> Mikrobiologia on yksi pääaineeni joten enköhän tiedä. Tiedän myös että

No mikset sitten kommentoi
https://trueorigin.org/mutations01.asp ?

> pitää olla äärettömän rajoittunut ja jähmettynyt putkiaivo jos jää
> roikkumaan tuohon sanaan "ääripää".

Sanoo jotain noin 20 vuotta vanhoja keskusteluja kaiveleva stenberi,
johonkin väitettyyn floppaamiseen takertuen, kun omat jutut nyt vuonna 2018
ovat tasoa "uskon holocaustiin, koska tyttäreni kävi joskus jollain
nimettömällä lomaleirillä".

>> Vaan ethän sinä puhunut mitään mistään muutoksista, vaan vertasit
>> jonkin mystisen nykyisen bakteerin infoa ihmislajin infoon.
>
> Juuri näin, onnitteluni! nykybakullla on vähemmän infoa solussa
> kun nykyihmisellä, mutta kummallekaan ei voi antaa (järkevää)
> numeerista arvoa.

Evoteoria ei edelleenkään väitä, että ihminen olisi kehittynyt nykybakuista.
Unohdit myös selittää
1. miten voit väittää, että vähemmän infoa, jos sinulla ei ole mitään tietoa
mistään numeroarvoista?
2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka tiedät
että se EI OLE kreationistien pääpointti? Siis miksi yrität koko ajan
pieksää jotain olkiukkoa sen asemesta, että vastaisit siihen mitä
kreatiedemiehet oikeasti argumentoivat geneettisestä informaatiosta??

--
--TJT--


TJT2

unread,
Jun 11, 2018, 4:55:10 AM6/11/18
to
Spekulointisi häiritsee tätä sinun ja minun välistä keskustelua koska tunget
ne spekulaatiosi näihin ketjuihin, joten sikäli liikuttaa. Ja tunnen aika
monta Tarvosta, yksi muistaakseni jopa kirjoitti minulle sakot
ylinopeudesta.

TJT2

unread,
Jun 11, 2018, 4:55:10 AM6/11/18
to
John Smith wrote:
> Tää nyt EI ole varaventtiiliasiaa, joten suksipa vittuun asiaryhmästä.

Tämä ON varaventtiiliasiaa, jotes suksi itse äitis persereikään, josta
ilmeisesti olet alunperinkin tullut.

--
--TJT--


TJT2

unread,
Jun 11, 2018, 4:55:10 AM6/11/18
to
Pekka Ala-Mäyry wrote:
> Fri, 08 Jun 2018 12:03:21 +0300, TJT2 kirjoitti:
>>> Onko tuossa "tarkka" kreationistinen takaportti?
>>
>> En ymmärrä kysymystä.
>
> Kun aina tartut lillukanvarsiin, niin mitä tarkoitat tuossa
> sanalla "tarkka"? Takaportti on toki yleensä JPK:n tahallisia
> ilmaisuja, joita käyttäen voi näppärästi kiistää
> mitä tuli sanotuksi.

Tarkoitan sitä numeerista lukuarvoa, ja viittaan edelleenkin hiekkakasa yms
analogihini. Ja kun minulla nyt on tässä näppiksen vierellä lasi jossa
maitoa, tässä taas uusi: Kaadoin jääkaapin vieressä lasiin JONKINVERRAN
maitoa, ja nyt olen juonut OSAN siitä maidosta, ja loput ovat tietenkin
edelleenkin lasissa (kun ei tällä kertaa tipahtanut lattialle). Minulla ei
ole mitään tietoa, montako millilitraa tai kuutiosenttiä tai muuta vastaavaa
yksikköä kaadoin lasiin, eikä minulla ole mitään tietoa montako millilitraa
tms join siitä, eikä minulla ole mitään tietoa montako millilitraa tmv
lasissa on edelleenkin maitoa, MUTTA OLEN ABSOLUUTTISEN VARMA ETTÄ SITÄ ON
NYT VÄHEMMÄN KUIN MITÄ OLI KUN LÄKSIN LASI KÄDESSÄ JÄÄKAAPILTA.

> Määrän muutoksen mittaaminen edellyttää, että on jokin
> yksikäsitteinen mitta, jonka perusteella mittaustulokset voidaan
> järjestää suuruusjärjestykseen. Mikä on tämä biologisen
> informaation mitta?

Kuten ylläoleva, juuri äsken testamaani juomalasiesimerkki osoittaa, lasissa
olevan maidon määrän vähenemisen osoittamiseen ei tarvita yhtään mitään
mittaa, vaan vain ja ainoastaan tietoa että olen juonut kyseistä lasista
TUNTEMATTOMAN määrän maitoa. Siis ainoa oleellinen tieto on se itse
vähennysprosessin tapahtuminen. Geneettisen infon suhteen pätee ihan sama.
Meillä on selvät havainnot prosesseista, jotka vähentävät geneettistä
inforamaatiota. Ei meidän tarvitse tietää, montako bittiä sitä alunperin
oli, montako bittiä vähennettiin, montako bittiä jäi jäljelle. Matematiikka
a = b - c pätee hiekkakasoihin, metsään, maitolasiin, geneettiseen
informaatioon ja yleensäkin kaikkeen, b MIINUS c kertoo, että beestä
vähennetään jotain. Reunaehto tietysti että positiivisia lukuja, mutta
tämähän on oikeastaan itsenstään selvyys, ei reaalimaailmassa ole mitään
miinusmerkkisiä hiekanjyviä eikä maitolitroja eikä infoa. (matematiikan
perussäännöt unohtaneille: miinus miinus on oikeasti plus)

>> ... olen ihan selvästi esittänyt näkemykseni että nimenomaan
>> määrän MUUTOSTA voidaan havainnoida ilman tarkkaa lukuarvoa,
>> siis sen tarkan arvon mittaamista
> Mutta myös tuossa tapauksessa biologisella informaatiolla pitää
> olla jokin määritelmä, että voidaan sanoa onko määrä kasvanut
> vai vähentynyt. Mikä on tuo määritelmä?

Niin, mitä määritelmää Kaj Stenberg käyttää, kun jankkaa että nykyihmisessä
enemmän infoa kuin nykybakussa?? En minä vaan tiedä, joten kysy
evotoveriltasi Kaj Stenbergiltä.

> Eräskin tarvonen on piirrellyt käppyröitään nettisivulleen
> http://personal.inet.fi/koti/tjt/evvaikea.html
> ja väittää jotain biologisen informaation määrästä. Minä ilmaisin
> mielipiteeni siitä, että noita käyriä ei voi piirrellä elleivät
> ne perustu johonkin määritelmään ja sen pohjalta tehtyyn mittaukseen.

En ole edelleenkään mitannut maitolasissani olevan maidon määrää, mutta olen
edelleenkin varma että kyllä se on vähentynyt. Itseasiassa näyttää olevan jo
niin vähissä, että kohta käytävä uudestaan jääkaapilla.

>> ... Olen myös kertonut näkemykseni, että John M. Smith on
>> tyhmä kun ei näe sitä toista vaihtoehtoa infon alkuperälle,
>> vaan yrittää epätoivoisesti selittää sitä ateistisessa
>> kontekstissa.
>
> Ai niin se idea, että jokin kaikkivaltias toimija olisi
> suunnitellut ne geenit sinne valmiina?

Luoja kuin luoja, ei sen välttämättä tarvitse olla kaikkivaltias, jotkun
UFO-uskovaisethan uskovat, että jotkut alienit kävivät luomassa maapallon
elämän.

> Tieteellinen ajatusmalli ei voi tietenkään käyttää tuollaista

Sanat "ateistinen" ja "tieteellinen" eivät edelleenkään ole synonyymejä.
Suosittelen edelleenkin FAQien lukemista, vaikka noin 20 vuoden
keskusteluhistorialla tiedänkin, että teikäläisillä ei ole aikomustakaan
noudattaa suosituksiani
https://creation.com/science-questions-and-answers
vaan eipä minullakaan ole aikomusta aloittaa samaa jankkausta lähtöruudusta.
Teikäläisille on osoitettu jo kymmenien vuosien ajan, että aito tiede
nimenomaan voi käyttää, joten jos sillä teikäläisten ateistisella
pseuditieteellä on ongelmia Luojan kanssa, se on teikäläisten oma häpeä.

> deus ex machina juonenkäänteitä. Ei ole olemassa mitään syytä
> olettaa että GDI.

Syitä on miljoonatolkulla, kuten viimeksikuluneen 20 vuoden aikana olen
täälläkin toistuvasti osoittanut. Elämän itsestäänsyntyminen on niin selvä
mahdottomuus, että teoriassa jää vain kaksi vaihtoehtoa, joista se "aina
ollut olemassa" kaatuu heti kättelyssä, joten ei siinä jää jäljelle mitään
muuta kuin "Luoja did it". Ja siihenkin on hyvät syyt olettaa, että se se
luoja oli nimenomaan G, koska esim UFO-selitys kaatuu siihen, että mistäs ne
alienit sitten tulivat? Alien loi alienin joka loi alienin jne ketjua ei voi
jatkaa loputtomasti, jossain on oltava se ketjun ensimmäinen lenkki.

> Onko mielestäsi on tyhmyyttä olla ottamatta GDI:tä huomioon
> tieteellisen teorian perusteissa?

On, minun ja kreatiedemiesten mielestä, kuten esim FAQ-osiossa
https://creation.com/science-questions-and-answers
on rautalangasta väännetty jo vuosia sitten. Kannattaa myös lukea osio
https://creation.com/philosophy-questions-and-answers
ja kaikki muutkin osiot
https://creation.com/qa

>>> Et vaan osaa...
>>
>> selittää niin että sinäkin ymmärtäisit että onko vastaust "ei" vai
>> "kyllä". Sinä esitit kysymyksen, joka periaatteessa on "kyllä vai
>> ei" kysymys, johon minä ystävällisenä ja asiallisena keskustelija
>> vastasin kirjoittamalla ne vastauksen perustelut itse vastaukseen.
>> Siis jos Sanfordin mukaan nuo 2 infoa ovat eri asioista, niin
>> pitäisi sinunkin tajuta, että vastaus on "ei". Varsinkin kun vielä
>> lisäsin, että Sanford esittänyt kritiikkiä... joten ilmeisesti
>> sinulle vastaaminen edellyttää jotain JPK:n aka JiiPeen tasolle
>> vajoamista, johon minä en taida kyetä.
>
> Eli Shannonilaisittain ei voida mitata biologisen informaation määrää
> kvantitatiivisesti. Shannonin teoria antaa kuitenkin jonkinlaisen
> ylärajan geenien informaatiolle. Onko olemassa mitään muuta tapaa
> mitata tuon biologisen informaation määrää kvantitatiivisesti?

Kummallisia fiksaatioita sinulla tuohon Shannoniin ja mittaamiseen. Koskaan
kuullut esim tästä
x x x
Chaitin-Kolmogoroff theory
Another way of measuring information content is the Kolmogorov complexity
(also known as Chaitin information).
x x x

> Ellei ole, niin kaikkia näitä kreationistiväitteitä voidaan kuvata
> sillä yllämainitulla akateemisella ilmaisulla. Jos taas tuollainen
> määrittely/mittaustapa kreationisteilta löytyy, niin päästä meidät
> jännityksestä ja kerro jo mikä se on.

Olen linkittänyt useita kertoja esim tuohon creationwikin artikkeliin,
puhumattakaann CMI:n, ICR:n, CRS:n, AiG:n jne artikkeleista, ja Sanfordin
jne kirjatkin mainittu kymmeniä tai satoja kertoja, joten syytön minä olen
jos sinä et vaivaudu katsomaan annettuja linkkejä, etkä näinollen ole
koskaan aikaisemmin törmännyt esim lauseeseen "Another way of measuring
information content is the Kolmogorov complexity ".

>>> Kuka on kieltänyt geneettisen informaation olemassaolon?
>>
>> Joku evolutionisti.
>
> Niin varmaan. Ei ainakaan kreationisti.

Niin, teillä evolutionisteilla on kova tarve kieltää erilaisia asioita, jos
ne jotenkin uhkaavat teidän ateistista maailmankuvaanne. Btw, oletko lukenut
Werner Gitt: In the Beginning was Information ? Ensimmäinen painos jo 1997,
ja kolmas 2001, joten ei mikään kovin tuore teos, mutta tuollakin puhutaan
kovasti Shannonista, ja jonkinlaista kritiikkiäkin näytäisi esiintyvän häntä
kohtaan.

--
--TJT--

Kaj Stenberg

unread,
Jun 11, 2018, 5:38:41 AM6/11/18
to
Den måndag 11 juni 2018 kl. 11:55:10 UTC+3 skrev TJT2:
> Kaj Stenberg wrote:

> > Mikrobiologia on yksi pääaineeni joten enköhän tiedä. Tiedän myös että
>
> No mikset sitten kommentoi
> https://trueorigin.org/mutations01.asp ?

No, tuo ei liity mikrobiologiaan vaan lähinnä molekyyligenetiikkaan.
Mutta se on kakkospääaineeni joten: Oikein hyvä juttu.
pikaisen läpiluvun löysin kaksi heikkoutta. Ensinnäkin kirjoittaja ei
tiedä geenituotteen (usein proteinin) rakennebiologiasta mitään. Tämä
heikkous näkyy kun hän keskustelee proteinifunktioista. Toinen
kritisoitava kohta on lajiutuminen, hän yliarvioi räikeästi mitä
vaaditaan jotta saataisiin aikaseksi uusi laji. Sympatrinen
lajiutuminen näyttäisi hänelle olla tuntematon?

> 1. miten voit väittää, että vähemmän infoa, jos sinulla ei ole mitään tietoa
> mistään numeroarvoista?

Jos tarkastelee kaksi asiaa joissa monen suuruusluokan ero voi hyvin erottaa ne toisistaan vaikka numeerista arvoa ei ole.

> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka tiedät
> että se EI OLE kreationistien pääpointti? Siis miksi yrität koko ajan
> pieksää jotain olkiukkoa sen asemesta, että vastaisit siihen mitä
> kreatiedemiehet oikeasti argumentoivat geneettisestä informaatiosta??

Jos perusväite on että jonkilainen "informaatiovähennys" olisi
havaittavissa ihan mutamassa sukupolvessa niin olisi pakko olla mittausmenetelmä, koska ykköskohdan "monen suuruusluokan ero" ei
täyty.

--
Kaj

Ari Saastamoinen

unread,
Jun 11, 2018, 9:16:19 AM6/11/18
to
"TJT2" <truth.i...@atheism.is.invalid> writes:

> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka
> tiedät että se EI OLE kreationistien pääpointti? Siis miksi

Miksi SINä sitten jatkuvasti jankkaat siitä, että informaation määrä
jatkuvasti (keskimäärin) muka vähenisi, jos tuo määrä kerran ei ole
pääpointti?

--
Arzka oh3mqu+...@hyper.fi - En halua follareita mailina
1. Valitse sopiva paikka, ei ihmisten tai rakennusten lahella, jossa
paukku voi aiheuttaa hairiota. - Iso-Kiinalaisen kayttoohje

Pekka Ala-Mäyry

unread,
Jun 11, 2018, 5:44:06 PM6/11/18
to
Mon, 11 Jun 2018 11:54:59 +0300, TJT2 kirjoitti:

> Pekka Ala-Mäyry wrote:
>> Fri, 08 Jun 2018 12:03:21 +0300, TJT2 kirjoitti:
>>>> Onko tuossa "tarkka" kreationistinen takaportti?
>>>
>>> En ymmärrä kysymystä.
>>
>> Kun aina tartut lillukanvarsiin, niin mitä tarkoitat tuossa
>> sanalla "tarkka"? Takaportti on toki yleensä JPK:n tahallisia
>> ilmaisuja, joita käyttäen voi näppärästi kiistää
>> mitä tuli sanotuksi.
>
> Tarkoitan sitä numeerista lukuarvoa, ja viittaan edelleenkin hiekkakasa yms
> analogihini. Ja kun minulla nyt on tässä näppiksen vierellä lasi jossa
> maitoa, tässä taas uusi: Kaadoin jääkaapin vieressä lasiin JONKINVERRAN
> maitoa, ja nyt olen juonut OSAN siitä maidosta, ja loput ovat tietenkin
> edelleenkin lasissa (kun ei tällä kertaa tipahtanut lattialle). Minulla ei
> ole mitään tietoa, montako millilitraa tai kuutiosenttiä tai muuta vastaavaa
> yksikköä kaadoin lasiin, eikä minulla ole mitään tietoa montako millilitraa
> tms join siitä, eikä minulla ole mitään tietoa montako millilitraa tmv
> lasissa on edelleenkin maitoa, MUTTA OLEN ABSOLUUTTISEN VARMA ETTÄ SITÄ ON
> NYT VÄHEMMÄN KUIN MITÄ OLI KUN LÄKSIN LASI KÄDESSÄ JÄÄKAAPILTA.

John Maynard Smithin artikkeli pohti juuri tällaisten analogoioiden
käyttöä: Jos analogia on vain kvalitatiivinen se voi yhtä hyvin johtaa
harhaan tai valaista. Tässä tapauksessa valitettavasti kysymyksessä on
edellinen tapaus.

>> Määrän muutoksen mittaaminen edellyttää, että on jokin
>> yksikäsitteinen mitta, jonka perusteella mittaustulokset voidaan
>> järjestää suuruusjärjestykseen. Mikä on tämä biologisen
>> informaation mitta?
>
> Kuten ylläoleva, juuri äsken testamaani juomalasiesimerkki osoittaa, lasissa
> olevan maidon määrän vähenemisen osoittamiseen ei tarvita yhtään mitään
> mittaa, vaan vain ja ainoastaan tietoa että olen juonut kyseistä lasista
> TUNTEMATTOMAN määrän maitoa. Siis ainoa oleellinen tieto on se itse
> vähennysprosessin tapahtuminen. Geneettisen infon suhteen pätee ihan sama.
> Meillä on selvät havainnot prosesseista, jotka vähentävät geneettistä
> inforamaatiota.
Tämä on taas tätä "rusinat pullasta" tai ns. "Däniken päättelyä".
Kreationistilla on ensin idea: GDI. Sen jälkeen kerätään vain kaikki
havainnot, jotka tukevat vain tätä GDI:tä. Jätetään kaikki inhottavat
ristiriitaisuudet maton alle.

Kreationistilogiikka pelkistettynä:
Meillä oli aluksi geneettinen info (GDI). On olemassa vain infoa
vähentäviä prosesseja. Näinollen info vähenee. Koska se vähenee, niin
sen on täytynyt syntyä jotenkin muuten. Siitä seuraa GDI.
...
>>> ... olen ihan selvästi esittänyt näkemykseni että nimenomaan
>>> määrän MUUTOSTA voidaan havainnoida ilman tarkkaa lukuarvoa,
>>> siis sen tarkan arvon mittaamista
>> Mutta myös tuossa tapauksessa biologisella informaatiolla pitää
>> olla jokin määritelmä, että voidaan sanoa onko määrä kasvanut
>> vai vähentynyt. Mikä on tuo määritelmä?
>
> Niin, mitä määritelmää Kaj Stenberg käyttää, kun jankkaa että nykyihmisessä
> enemmän infoa kuin nykybakussa?? En minä vaan tiedä, joten kysy
> evotoveriltasi Kaj Stenbergiltä.
>
>> Eräskin tarvonen on piirrellyt käppyröitään nettisivulleen
>> http://personal.inet.fi/koti/tjt/evvaikea.html
>> ja väittää jotain biologisen informaation määrästä. Minä ilmaisin
>> mielipiteeni siitä, että noita käyriä ei voi piirrellä elleivät
>> ne perustu johonkin määritelmään ja sen pohjalta tehtyyn mittaukseen.
>
> En ole edelleenkään mitannut maitolasissani olevan maidon määrää, mutta olen
> edelleenkin varma että kyllä se on vähentynyt. Itseasiassa näyttää olevan jo
> niin vähissä, että kohta käytävä uudestaan jääkaapilla.

Tuo henkilökohtaisen uskon tuoman varmuuden perusteella ei oikein voi
tehdä mitään loogisia päätelmiä.

>>> ... Olen myös kertonut näkemykseni, että John M. Smith on
>>> tyhmä kun ei näe sitä toista vaihtoehtoa infon alkuperälle,
>>> vaan yrittää epätoivoisesti selittää sitä ateistisessa
>>> kontekstissa.
>>
>> Ai niin se idea, että jokin kaikkivaltias toimija olisi
>> suunnitellut ne geenit sinne valmiina?
>
> Luoja kuin luoja, ei sen välttämättä tarvitse olla kaikkivaltias, jotkun
> UFO-uskovaisethan uskovat, että jotkut alienit kävivät luomassa maapallon
> elämän.
>
>> Tieteellinen ajatusmalli ei voi tietenkään käyttää tuollaista
>
> Sanat "ateistinen" ja "tieteellinen" eivät edelleenkään ole synonyymejä.

Jos olisit perehtynyt tieteenfilosofiaan, niin tietäisit millä
työkaluilla tiede operoi. Tiedän, että kreationistejä jurppii, kun GDI
ei todista mitään tieteen puolella. ID-kreationistit yrittävät sumuttaa
verhoamalla itsensä tieteen näköiskaapuun, mutta taustalla on silti
kreationistinen strategia.

> Suosittelen edelleenkin FAQien lukemista, vaikka noin 20 vuoden
> keskusteluhistorialla tiedänkin, että teikäläisillä ei ole aikomustakaan
> noudattaa suosituksiani
> https://creation.com/science-questions-and-answers
> vaan eipä minullakaan ole aikomusta aloittaa samaa jankkausta lähtöruudusta.
> Teikäläisille on osoitettu jo kymmenien vuosien ajan, että aito tiede
> nimenomaan voi käyttää, joten jos sillä teikäläisten ateistisella
> pseuditieteellä on ongelmia Luojan kanssa, se on teikäläisten oma häpeä.

Heh heh. Jurppiiko?

>> deus ex machina juonenkäänteitä. Ei ole olemassa mitään syytä
>> olettaa että GDI.
>
> Syitä on miljoonatolkulla, kuten viimeksikuluneen 20 vuoden aikana olen
> täälläkin toistuvasti osoittanut. Elämän itsestäänsyntyminen on niin selvä
> mahdottomuus, että teoriassa jää vain kaksi vaihtoehtoa, joista se "aina
> ollut olemassa" kaatuu heti kättelyssä, joten ei siinä jää jäljelle mitään
> muuta kuin "Luoja did it". Ja siihenkin on hyvät syyt olettaa, että se se
> luoja oli nimenomaan G, koska esim UFO-selitys kaatuu siihen, että mistäs ne
> alienit sitten tulivat? Alien loi alienin joka loi alienin jne ketjua ei voi
> jatkaa loputtomasti, jossain on oltava se ketjun ensimmäinen lenkki.

Nämä ylläolevat ovat vain henkilökohtaisen epäuskon argumentteja siitä
että elämä voisi syntyä ilman ulkoista toimijaa.

>> Onko mielestäsi on tyhmyyttä olla ottamatta GDI:tä huomioon
>> tieteellisen teorian perusteissa?
>
> On, minun ja kreatiedemiesten mielestä, kuten esim FAQ-osiossa
> https://creation.com/science-questions-and-answers
> on rautalangasta väännetty jo vuosia sitten. Kannattaa myös lukea osio
> https://creation.com/philosophy-questions-and-answers
> ja kaikki muutkin osiot
> https://creation.com/qa

Kreationistitiede on oksymoroni. Voivat omassa puluparvessaan
kujerrella keskenään mitä vaan.

>>>> Et vaan osaa...
>>>
>>> selittää niin että sinäkin ymmärtäisit että onko vastaust "ei" vai
>>> "kyllä". Sinä esitit kysymyksen, joka periaatteessa on "kyllä vai
>>> ei" kysymys, johon minä ystävällisenä ja asiallisena keskustelija
>>> vastasin kirjoittamalla ne vastauksen perustelut itse vastaukseen.
>>> Siis jos Sanfordin mukaan nuo 2 infoa ovat eri asioista, niin
>>> pitäisi sinunkin tajuta, että vastaus on "ei". Varsinkin kun vielä
>>> lisäsin, että Sanford esittänyt kritiikkiä... joten ilmeisesti
>>> sinulle vastaaminen edellyttää jotain JPK:n aka JiiPeen tasolle
>>> vajoamista, johon minä en taida kyetä.
>>
>> Eli Shannonilaisittain ei voida mitata biologisen informaation määrää
>> kvantitatiivisesti. Shannonin teoria antaa kuitenkin jonkinlaisen
>> ylärajan geenien informaatiolle. Onko olemassa mitään muuta tapaa
>> mitata tuon biologisen informaation määrää kvantitatiivisesti?
>
> Kummallisia fiksaatioita sinulla tuohon Shannoniin ja mittaamiseen. Koskaan
> kuullut esim tästä
> x x x
> Chaitin-Kolmogoroff theory
> Another way of measuring information content is the Kolmogorov complexity
> (also known as Chaitin information).
> x x x

Kolmogorov kompleksisuus on kyllä tuttu. Määritelmä on hieno, mutta
sillä ei valiettavasti tee mitään. Ei ole mitään keinoa kertoa jostain
datasta mikä olisi yksinkertaisin tapa tuottaa se. Joten tämä ei
pelasta sinua tai muita kreationisteja - sorry.

>> Ellei ole, niin kaikkia näitä kreationistiväitteitä voidaan kuvata
>> sillä yllämainitulla akateemisella ilmaisulla. Jos taas tuollainen
>> määrittely/mittaustapa kreationisteilta löytyy, niin päästä meidät
>> jännityksestä ja kerro jo mikä se on.
>
> Olen linkittänyt useita kertoja esim tuohon creationwikin artikkeliin,
> puhumattakaann CMI:n, ICR:n, CRS:n, AiG:n jne artikkeleista, ja Sanfordin
> jne kirjatkin mainittu kymmeniä tai satoja kertoja, joten syytön minä olen
> jos sinä et vaivaudu katsomaan annettuja linkkejä, etkä näinollen ole
> koskaan aikaisemmin törmännyt esim lauseeseen "Another way of measuring
> information content is the Kolmogorov complexity ".

Kuten sanoin tuota ei voi laskea.
Voisit joskus itse tarkistaa näitä kreationistien propagandaväitteitä.
Luulevat tietysti, että kukaan (ml. sinä) ei viitsi selvittää jonkin
hienolta kuulostavan temin merkitystä. Todistaa 0.

>>>> Kuka on kieltänyt geneettisen informaation olemassaolon?
>>>
>>> Joku evolutionisti.
>>
>> Niin varmaan. Ei ainakaan kreationisti.
>
> Niin, teillä evolutionisteilla on kova tarve kieltää erilaisia asioita, jos
> ne jotenkin uhkaavat teidän ateistista maailmankuvaanne. Btw, oletko lukenut
> Werner Gitt: In the Beginning was Information ? Ensimmäinen painos jo 1997,
> ja kolmas 2001, joten ei mikään kovin tuore teos, mutta tuollakin puhutaan
> kovasti Shannonista, ja jonkinlaista kritiikkiäkin näytäisi esiintyvän häntä
> kohtaan.

Niin kai. Pakko kritisoida kun muuta informaation laskentaa eivät ole
keksineet ja Shannon antaa kreationistien mielestä vääriä tuloksia.
Däniken logiikalla lakaisemme Shannonin maton alle.

--
pam

Ari Saastamoinen

unread,
Jun 12, 2018, 2:17:45 AM6/12/18
to
"TJT2" <truth.i...@atheism.is.invalid> writes:

> tapahtuminen. Geneettisen infon suhteen pätee ihan sama. Meillä on
> selvät havainnot prosesseista, jotka vähentävät geneettistä
> inforamaatiota.

Mutta kun ei ole näyttöä prosessista, joka ainoastaan vähentää
geneettistä informaatiota.

> "Luoja did it". Ja siihenkin on hyvät syyt olettaa, että se se luoja
> oli nimenomaan G, koska esim UFO-selitys kaatuu siihen, että mistäs
> ne alienit sitten tulivat?

Toi G selitys kaatuu ihan täysin samaan asiaan.

Kaj Stenberg

unread,
Jun 12, 2018, 12:59:31 PM6/12/18
to
Den onsdag 6 juni 2018 kl. 11:03:27 UTC+3 skrev TJT2:

> Vaan oletko lukenut Sanfordin kirjan Genetic Entropy and The Mystery of the
> Genome? Tai sen suomenkielisen version Eliömaailma rappeutuu?

Onko kukaan löytänyt jatko-osan "handwavings to why different species
appear and disappear in different strata"?

--
Kaj

Kaj Stenberg

unread,
Jun 12, 2018, 5:57:37 PM6/12/18
to
Den måndag 11 juni 2018 kl. 11:55:10 UTC+3 skrev TJT2:
> Kaj Stenberg wrote:

> Unohdit myös selittää
> 1. miten voit väittää, että vähemmän infoa, jos sinulla ei ole mitään tietoa
> mistään numeroarvoista?

Ilman numeroarvojakin voi melko varmasti erottaa toisistaan alemman 1 persentiilin ylimmästä 1 persentiilistää.

Ajatusta "rappeutumisesta" sukupolvesta toiseen on sinänsä ihan hyvin
perusteltu ajatusmalli, Sanfordin esittämänä. (Ei sinun). Mutta kun
puuttuu havaintoja/"dataa" tukemaan ko. ajatusmallia.. (Lienee turhaa
mainita ajoituksia joista virhe taitaa lähteä).

> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka tiedät
> että se EI OLE kreationistien pääpointti? Siis miksi yrität koko ajan
> pieksää jotain olkiukkoa sen asemesta, että vastaisit siihen mitä
> kreatiedemiehet oikeasti argumentoivat geneettisestä informaatiosta??

Koska "geneettinen informaatio" (jolla muuten on ainakin kaksi varsin eri merkitystä, riippuen missä biotieteessä liikutaan) on niin mahdotonta _kvantifioida_.

--
Kaj

TJT2

unread,
Jun 15, 2018, 4:47:29 AM6/15/18
to
Kaj Stenberg wrote:
> Den måndag 11 juni 2018 kl. 11:55:10 UTC+3 skrev TJT2:
>> Kaj Stenberg wrote:
>>> Mikrobiologia on yksi pääaineeni joten enköhän tiedä. Tiedän myös
>>> että
>> No mikset sitten kommentoi
>> https://trueorigin.org/mutations01.asp ?
>
> No, tuo ei liity mikrobiologiaan vaan lähinnä molekyyligenetiikkaan.
> Mutta se on kakkospääaineeni joten: Oikein hyvä juttu.

Rasti seinään, Stenberg kehuu jo toisen kerran kreatiedemiesten
artikkeleita.

> pikaisen läpiluvun löysin kaksi heikkoutta. Ensinnäkin kirjoittaja ei
> tiedä geenituotteen (usein proteinin) rakennebiologiasta mitään. Tämä

Ihan varmasti tietää.

> heikkous näkyy kun hän keskustelee proteinifunktioista. Toinen

Niin millä tavalla se näkyy? Et vaivautunut kirjoittamaan auki tuota
väitettäsi millään tavalla, ja sitten P de G syyttää minua että en muka
kirjoita auki... Tässäkin siis taas oiva esimerkki, kuinka projisoitte omat
virheenne ja muut puutteenne minuun, kun ette pärjää asiakysymyksissä.

> kritisoitava kohta on lajiutuminen, hän yliarvioi räikeästi mitä
> vaaditaan jotta saataisiin aikaseksi uusi laji. Sympatrinen
> lajiutuminen näyttäisi hänelle olla tuntematon?

Kyllä hän sen tuntee. Ja tässäkään et kirjoita mitään auki, vaan
idioottimaisesti spekuloit kirjoittajan tietotasolla. Joka tässä tapauksessa
on suorastaan tragikoomista
x x x
Jerry Bergman has seven degrees, including in biology, psychology, and
evaluation and research, from Wayne State University, in Detroit, Bowling
Green State University in Ohio, and Medical College of Ohio in Toledo. He
has taught at Bowling Green State University, the University of Toledo,
Medical College of Ohio and at other colleges and universities. He
currently teaches biology, microbiology, biochemistry, and human anatomy at
the college level and is a research associate involved in research in the
area of cancer genetics. He has published widely in both popular and
scientific journals
x x x
ja päivitetympi versio, 9 tutkintoa, montakos sinulla??
x x x
erry Bergman has taught biology, genetics, chemistry, biochemistry,
anthropology, geology, and microbiology at Northwest State College in
Archbold OH for over 25 years. He has 9 degrees, including 7 graduate (=
‘post-graduate’ in some non-US systems) degrees. Dr Bergman is a graduate of
Medical College of Ohio, Wayne State University in Detroit, The University
of Toledo, and Bowling Green State University. He has over 800 publications
in 12 languages and 20 books and monographs.
x x x
https://creation.com/dr-jerry-bergman
ja
http://creationwiki.org/Jerry_Bergman

>> 1. miten voit väittää, että vähemmän infoa, jos sinulla ei ole
>> mitään tietoa mistään numeroarvoista?
>
> Jos tarkastelee kaksi asiaa joissa monen suuruusluokan ero voi hyvin
> erottaa ne toisistaan vaikka numeerista arvoa ei ole.

Juuri tätä olen täällä noin 20 vuotta selittänyt, mukavaa että edes yhdelle
sfnettiläiselle meni jakeluun. Mitenkähän saisimme ne loput, jotka
jankkaavat "ei voi mitata, joten eroja ei voi erottaa", ymmärtämään edes
tuon?

>> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka
>> tiedät että se EI OLE kreationistien pääpointti? Siis miksi yrität
>> koko ajan pieksää jotain olkiukkoa sen asemesta, että vastaisit
>> siihen mitä kreatiedemiehet oikeasti argumentoivat geneettisestä
>> informaatiosta??
>
> Jos perusväite on että jonkilainen "informaatiovähennys" olisi

Niin, JOS. Asiallinen keskustelija quottaa vastapuolen väitteen eikä rupea
jossittelemaan.

> havaittavissa ihan mutamassa sukupolvessa niin olisi pakko olla
> mittausmenetelmä, koska ykköskohdan "monen suuruusluokan ero" ei
> täyty.

Erilaisia mittausmenetelmiä on esitetty, esim perinnöllisten sairauksien
kasvu ihmislajilla, gepardin heterotsygotia ja polymorfisten geenien määrä,
antibioottiresistenssin mekanismit, jne. Sanfordin kirja tuntuu pelottavan
sinua liikaa, mutta mites vanha kunnon "Evoluutio - kriittinen analyysi"?
Minulla on siitä ihan Leisolan nimmarilla varustettu, mites sulla?

--
--TJT--
I know no greater pleasure, no deeper satisfaction than to speak the truth.


TJT2

unread,
Jun 15, 2018, 4:47:29 AM6/15/18
to
Ari Saastamoinen wrote:
> "TJT2" <truth.i...@atheism.is.invalid> writes:
>
>> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka
>> tiedät että se EI OLE kreationistien pääpointti? Siis miksi
>
> Miksi SINä sitten jatkuvasti jankkaat siitä, että informaation määrä
> jatkuvasti (keskimäärin) muka vähenisi, jos tuo määrä kerran ei ole
> pääpointti?

Siis se määrän väheneminen ON pääpointti, mutta vähenemisen tarkka lukuarvo
EI OLE pääpointti. Vertaus: Ilmastovouhottajatkin vouhottavat siitä, kuinka
ilmasto lämpenee, siis puhuvat lämmön määrän lisääntymisestä, mutta heillä
ei ole mitään tarkkaa numeerista arvoa, vaan erilaiset ennusteet ja arviot
hyppivät jossain alle yhden asteen ja yli 10 asteen välissä. Joku vouhottaja
jopa aikoinaan ennusteli, että napa-alueilla ainakin 12 astetta lisää siihen
keskiarvoon, ja pohjoisnavalla avomeri jo vuonna 2010 tjsp. Tästähän YLEn
MOT sai idean siihen "Hei me melotaan" jaksoon, jossa osoitettiin että
kanootti etenee aika heikosti paksussa umpijäässä...

Ilmastovouhottajat siis puhuvat oikeasti lämmön derivaatasta, me
kreationistit informaation derivaatasta, ilmastovouhottajat todistelevat
että sen heidän derivaattansa etumerkki on plus, me kreationistit
todistelemme että infon derivaatan etumerkki on miinus. Ilmastovouhottajat
eivät kykene sanomaan tarkkaa astelukua emmekä me kykene sanomaan tarkkaa
bittilukua.

Siis se derivaatan etumerkki on se pääpointti, ei se etumerkin jälkeen
tulevan numeron tarkka arvo. Kuten mielestäni olen täällä jo noin 20 vuotta
selittänyt, joten tässäkin herää kysymys, että eikö tämä todellakaan mene
jakeluun, vai mistä on kyse??

--
--TJT--
The truth is now called hate, but I'll defend it anyway.


TJT2

unread,
Jun 15, 2018, 4:47:29 AM6/15/18
to
Kaj Stenberg wrote:
> Den måndag 11 juni 2018 kl. 11:55:10 UTC+3 skrev TJT2:
>> Kaj Stenberg wrote:
>> Unohdit myös selittää
>> 1. miten voit väittää, että vähemmän infoa, jos sinulla ei ole
>> mitään tietoa mistään numeroarvoista?
>
> Ilman numeroarvojakin voi melko varmasti erottaa toisistaan alemman 1
> persentiilin ylimmästä 1 persentiilistää.

Hienoa, että olemme kerrankin samaa mieltä.

> Ajatusta "rappeutumisesta" sukupolvesta toiseen on sinänsä ihan hyvin
> perusteltu ajatusmalli, Sanfordin esittämänä. (Ei sinun). Mutta kun

Ja ennen Sanfordia sitä ovat esittäneet monet muutkin, ja jo itse Charles
Darwin teki eron rappeutumisen ja kehityksen välille, mutta virheelliseti
oletti derivaatan etumerkin olevan plus. (Darwin ei tietenkään
matikkavammaisena puhunut mitään derivaatoista, eikä 1800-luvulla tunnettu
DNA:ta yms juttuja, joten hän ei puhunut infostakaan, vaan Darwin mittasi
edistymistä ja taantumista ihan muilla mittareilla, joka sekin osaltaan
johti häntä pahasti harhaan, mutta itse konseptin kahdesta eri suunnasta hän
ymmärsi, toisin kuin eräät sfnettiläiset).

> puuttuu havaintoja/"dataa" tukemaan ko. ajatusmallia.. (Lienee turhaa
> mainita ajoituksia joista virhe taitaa lähteä).

Mitkä ihmeen ajoitukset? Rb-Sr isokronit yms eivät nyt liity tähän
mitenkään, ja sitä dataa on vaikka kuinka paljon, kuten tietäisit jos
vaivautuisit lukemaan suosittelemani kirjat ja artikkelit. Sanfordin
kirjassa on jopa liitteenä viittauksia teikäläisten omiin papereihin.
Minulla valitettavasti on vaikeuksia päästä käsiksi kyseisiin papereihin,
mutta sinulla ei pitäisi olla jos oikeasti olet töissä jossain yliopistossa.

>> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista, vaikka
>> tiedät että se EI OLE kreationistien pääpointti? Siis miksi yrität
>> koko ajan pieksää jotain olkiukkoa sen asemesta, että vastaisit
>> siihen mitä kreatiedemiehet oikeasti argumentoivat geneettisestä
>> informaatiosta??
>
> Koska "geneettinen informaatio" (jolla muuten on ainakin kaksi varsin
> eri merkitystä, riippuen missä biotieteessä liikutaan) on niin
> mahdotonta _kvantifioida_.

Ja onko joku kreatiedemies joskus jossain väittänyt, että ihan helposti voi
kvantifioida?? Jos ei, pieksät edelleenkin olkiukkoa. Jos on, kerro kuka
missä milloin.

--
--TJT--
The only thing that appears to be evolving is 'evolution,' and it's becoming
more and more absurd.


Kaj Stenberg

unread,
Jun 15, 2018, 4:58:42 AM6/15/18
to
Den fredag 15 juni 2018 kl. 11:47:29 UTC+3 skrev TJT2:
> Kaj Stenberg wrote:

> > Jos tarkastelee kaksi asiaa joissa monen suuruusluokan ero voi hyvin
> > erottaa ne toisistaan vaikka numeerista arvoa ei ole.
>
> Juuri tätä olen täällä noin 20 vuotta selittänyt, mukavaa että edes yhdelle
> sfnettiläiselle meni jakeluun. Mitenkähän saisimme ne loput, jotka
> jankkaavat "ei voi mitata, joten eroja ei voi erottaa", ymmärtämään edes
> tuon?

Avainsana yllä on "monen suuruusluokan ero".

--
Kaj

Ari Saastamoinen

unread,
Jun 15, 2018, 10:56:21 PM6/15/18
to
"TJT2" <revisionis...@holocaust.is.invalid> writes:

> Ilmastovouhottajat siis puhuvat oikeasti lämmön derivaatasta, me
> kreationistit informaation derivaatasta, ilmastovouhottajat
> todistelevat että sen heidän derivaattansa etumerkki on plus, me
> kreationistit todistelemme että infon derivaatan etumerkki on
> miinus. Ilmastovouhottajat eivät kykene sanomaan tarkkaa astelukua
> emmekä me kykene sanomaan tarkkaa bittilukua.

> Siis se derivaatan etumerkki on se pääpointti, ei se etumerkin jälkeen
> tulevan numeron tarkka arvo. Kuten mielestäni olen täällä jo noin 20

Ilmastotyypit pystyvät sentään antamaan ihan tarkkoja mittaustuloksia
jo toteutuneista lämpötiloista, ja niistä sitten pyrkivät
extrapoloimaan tulevaa. Mutta kreationistit eivät pysty antamaan
minkäänlaisia mittaustuloksia geneettisen informaation määrästä, joten
siitä derivaatan etumerkistä ei pysty tekemään edes valistunutta
arvausta minkään olemassaolevan datan perusteella.

Raimo Suonio

unread,
Jun 24, 2018, 12:54:04 PM6/24/18
to
Itse Kaj Stenberg virkkoi, noin nimesi:

> Den mĆndag 11 juni 2018 kl. 11:55:10 UTC+3 skrev TJT2:
>> 2. miksi ylipäätään jankkaat jostain numeerisista arvoista,
>> vaikka tiedät että se EI OLE kreationistien pääpointti? Siis
>> miksi yrität koko ajan pieksää jotain olkiukkoa sen asemesta,
>> että vastaisit siihen mitä kreatiedemiehet oikeasti
>> argumentoivat geneettisestä informaatiosta?
> ?
>
> Jos perusväite on että jonkilainen "informaatiovähennys" olisi
> havaittavissa ihan mutamassa sukupolvessa niin olisi pakko olla
> mittausmenetelmä, koska ykköskohdan "monen suuruusluokan ero" ei
> täyty.

Jerry Bergman artikkelissaan kirjoittaa: "Not a single clear example
of an information-gaining mutation was located. It was concluded that
molecular biology research shows that information-gaining mutations
have not yet been documented." Sama väite toistuu monissa
kreationistisissa lähteissä (esimerkiksi Lee Spetner: "All point
mutations that have been studied on the molecular level turn out to
reduce the genetic information and not increase it") ja sitä on jo
vuosikausia toistanut myös Timo Tarvonen.

Rehellinen ja ammattitaitoinen tiedemies ei tietenkään voisi
kirjoittaa noin, ellei hänellä olisi varmaa, objektiivista tietoa
väitteensä tueksi. Kun tieteestä on kysymys, paras tieto olisi
tietenkin numeerinen, mitattu ja laskettu tieto. Tarvonen yritti
vuosia sitten tarjota numeerista tietoa vastaukseksi, mutta kun
osoitin Lee Spetnerin laskelmat bitin murto-osista huuhaaksi, Tarvonen
siirtyi viittaamaan John Sanfordiin.

Vaikka Tarvonen on ryhmän tehokkain kopiokone, hän ei ole kertaakaan
referoinut, mitä Sanford kirjassaan sanoo geneettisestä
informaatiosta. Paitsi että Tarvosen kertoman mukaan Sanford sanoo,
millä tavoin kreationistit EIVÄT laske geneettistä informaatiota. Ja
se menetelmä on Claude Shannonin menetelmä.

Tuo tieto ei paljon auta. Eivätkä auta myöskään Tarvosen hienot
analogiat hiekkakasoista ja maitolaseista, joilla hän pyrki
osoittamaan, ettei tarvitse tietää täsmällisiä määriä tietääkseen,
mihin suuntaan määrä on muuttunut.

No, kyllä minäkin sen tiedän, että jos maitolasista juo, maidon määrä
lasissa vähenee. Mutta miten geneettisen informaation määrän
muutoksen suunta eli etumerkki selvitetään esimerkiksi tässä
esimerkkitapauksessa:

Tässä ei ole kyse analogiasta vaan ihan aidosta tapauksesta. Alla on
pätkä olemassa olevasta ihmisen geenistä ja sen mutatoituneesta
muodosta. Esillä on 90 kirjainta, mutta geenissä on vielä noin 450
kirjainta lisää; ne voidaan kuitenkin olettaa identtisiksi noiden
kahden version välillä. Kyseinen mutaatio, joka oli luonnollisesti
mukana Bergmanin metatutkimuksessakin, on esitetyn pätkän kirjaimessa
20. Ensimmäisessä versiossa se on A, toisessa T.

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC
GTGGATGAAGTTGGTGGTGAGGCCCTGGGC...

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC
GTGGATGAAGTTGGTGGTGAGGCCCTGGGC...

En kerro, kumpi on alkuperäinen ja kumpi mutatoitunut muoto. En kerro
myöskään, mistä geenistä on kyse, eli miten geeni näkyy ilmiasussa eli
fenotyypissä. Jätän tämän fenotyyppi-tiedon kertomatta, koska
Tarvonen vastikään kirjoitti näin: "Rappeutumista tai kehitystä ei
mitata sillä, onko joku jotenkin mystisesti hyvä tai huono, vaan
geneettisen informaation muutoksella."

Yllä olevat kirjainjonot ovat juuri sitä geneettistä informaatiota.
Ja niiden välillä on tapahtunut muutos jompaankumpaan suuntaan.
Tarvosen väitteiden ja analogioiden perusteella noista kirjainjonoista
pitäisi varmasti ("Jokaisen normaalin ihmisen logiikan mukaan tiedämme
täysin varmasti, että kasa on kutistunut", "MUTTA OLEN ABSOLUUTTISEN
VARMA ETTÄ SITÄ ON NYT VÄHEMMÄN") tietää, onko niiden geneettisen
informaation määrissä eroa ja jos on, kummassa on enemmän ja kummassa
vähemmän.

Tosin Tarvonen sanoi maitolasillisensa yhteydessä, että: "Siis ainoa
oleellinen tieto on se itse vähennysprosessin tapahtuminen." Ja
geenin tapauksessahan se on tietenkin sen mutaation tapahtuminen.
Siis yllä olevassa esimerkissä A:n muuttuminen T:ksi tai T:n
muuttuminen A:ksi. Mitään muuta muutostahan ei tässä yhteydessä
tapahdu geenissä.

Tarvosen räyhääminen ja hölmöjen analogioiden keksiminen on täysin
turhaa. Minulle riittäisi, että joku kreationisti kertoisi, miten
yllä olevassa todellisessa esimerkissä voidaan pätevän perustellusti
päätellä geneettisen informaation muutoksen suunta. Sillä jos sitä ei
voi tehdä, kaikki Tarvosen, Bergmanin, Sanfordin ja kaikkien muiden
kreationistien väitteet yleisestä ja trendinomaisesta rappeutumisesta
ovat täysin pohjaa vailla.



Vaikka Tarvonen viime aikoina oli jo siirtynyt sanomaan, etteivät
kreationistit mitään lukuarvoja olekaan väittäneet geneettisestä
informaatiosta tai sen muutoksista ("Ja väitit että ihmisissä enemmän,
vaikka et mitään numeroarvoja antanutkaan, vaan enhän minäkään ole
antanut, eikä muut kreationistit"), hän pari viikkoa sitten oli
löytänyt uuden informaatioon liittyvän nimen ja Viisaana Mattina
kyseli meiltä: "Koskaan kuullut esim tästä: Chaitin-Kolmogoroff
theory".

Hän olisi itse kuullut Kolmogorovista jo kauan sitten, jos viitsisi
lukea viestejäni. Olen kirjoittanut Kolmogorovin kompleksisuudesta
aika seikkaperäisestikin ainakin vuosina 2001, 2006, 2007, 2012 ja
2015:

<https://groups.google.com/d/msg/sfnet.keskustelu.evoluutio/zJd8yn9IYO
o/taaujPI08VAJ>

<https://groups.google.com/d/msg/sfnet.keskustelu.evoluutio/nYLoHqDDPr
A/eG8vEjnWb3wJ>

<https://groups.google.com/d/msg/sfnet.keskustelu.evoluutio/Ow9wxyaf6q
4/Sg4P9FDPYuUJ>

<https://groups.google.com/d/msg/sfnet.keskustelu.evoluutio/WnGyV2nl49
U/IuJaRXxQOkIJ>

<https://groups.google.com/d/msg/sfnet.keskustelu.evoluutio/G2wxyKyCWE
E/6_2X3atJBgAJ>

Juhapekkamaiseen tapaan hän oli muotoillut sanomisensa siten, että jos
joku innostuisi, että Kolmogorovhan todellakin ratkaisee asian, hän
olisi voinut kehua, että ainahan hän on sanonut kreationistien osaavan
nuo informaatioasiat. Tai jos olisi todettu, ettei Kolmogorov pysty
geneettiseen informaatioon, hän olisi tuinahtanut, että aina te
olkiukkoja pieksätte ja valehtelette, enhän minä väittänyt
Kolmogorovin liittyvän geneettiseen informaatioon mitenkään.

Koska olen käsitellyt Kolmogorovia jo aikaisemmin varsin
yksityiskohtaisestikin, teen nyt vain hyvin lyhyen analyysin:

DNA:n koodi muistuttaa kaikilla mittareilla mitaten lähes täysin
satunnaisdataa. Siinä esiintyy hiukan paikallisia jaksoja ja kodoni-
tasolla end-koodi poikkeaa frekvenssiltään oleellisesti muista. Muu
näyttää satunnaiselta.

Kolmogorovin kompleksisuus ilmoittaa paradoksaalisesti puhtaan
satunnaisdatan informaatiosisällön maksimiksi. Ja se informaatiomäärä
on identtinen Claude Shannonin informaatioteorian ilmoittaman
informaatiomäärän kanssa. DNA-koodin tapauksessa Kolmogorovin
menetelmä redusoituu Shannonin menetelmäksi.

Ja Sanford on sanonut, että Shannonilla geneettistä informaatiota ei
missään tapauksessa lasketa. MOT.



Kun nyt tässä aihepiirissä liikutaan, esitän ratkaistavaksenne erään
ajatuskokeen:

Oletetaan suhteellisen tiivis, varsin homogeenisessa ekolokerossa
elävä populaatio, joka on hyvin sopeutunut elinympäristöönsä.

Joskus, sattumalta samoihin aikoihin, populaatioon syntyy mutaatioiden
kautta kolme eri sukulinjaa. Tarkastellaan tilannetta vasta kolmannen
sukupolven kohdalla, jotta tilastollisuudella olisi jo selvää
vaikutusta.

Kaikissa noissa sukulinjoissa näkyvänä merkkinä mutaatioista on uusi
ominaisuus, joka on sama kaikissa sukulinjoissa ja joka on selvästi
hyödyllinen uusi ominaisuus populaatiossa.

Tuo yhteinen uusi ominaisuus on kuitenkin syntynyt kussakin
sukulinjassa erilaisin mutaatioin siten, että:

Sukulinjassa A geneettinen informaatio on lisääntynyt.

Sukulinjassa B geneettinen informaatio on pysynyt samana.

Sukulinjassa C geneettinen informaatio on vähentynyt.

En määrittele tarkemmin näitä informaation muutoksia. Jokainen saa
olettaa oman näkemyksensä asiaan, jolloin siitä asiasta ei ainakaan
tarvitse ruveta riitelemään. Sanon vain, että mutaatiot voisivat
vastapainona "rikkoa" geenejä, jotka vastaisivat sellaisista vähän
merkityksellisistä asioista kuin vaikkapa aasin säkäristi tai okapin
peräpään raidoitus tai vastaavat ominaisuudet.

Ajatuskokeen kysymys kuuluu näin (kaikki saavat vastata):

Mitä arvelette evoluutioteorian (siinä muodossa kuin sen ymmärrätte,
tarvitsematta hyväksyä sen oikeellisuutta) ennustavan noiden kolmen
sukulinjan kohtaloksi?

X) Katoavatko ne lyhyessä ajassa populaatiosta?

Y) Pitävätkö ne aikojen päähän suhteellisen osuutensa populaatiosta?

Z) Valloittavatko ne koko populaation?

Tarkoitus ei ole jakaa noita kolmea skenaariota kolmelle sukulinjalle,
vaan valita mikä vain skenaario kullekin sukulinjalle. Voi siis sanoa
esimerkiksi, että kaikki sukulinjat katoavat muutamassa sukupolvessa.

Raimo Suonio

unread,
Jun 24, 2018, 10:41:49 PM6/24/18
to
Itse Raimo Suonio virkkoi, noin nimesi:

> Kun nyt tässä aihepiirissä liikutaan, esitän ratkaistavaksenne
> erään ajatuskokeen:

Vaikka yritin olla huolellinen, eräs seikka jäi mainitsematta:

Toivoisin, että perustelisitte vastauksenne oman
evoluutioteoriakäsityksenne pohjalta. Siis yrittäisitte selittää,
miten evoluutioteoria teidän mielestänne johtuisi ennustamaan
valitsemianne tapahtumakulkuja.

Kaj Stenberg

unread,
Jun 25, 2018, 7:53:27 AM6/25/18
to
Den söndag 24 juni 2018 kl. 19:54:04 UTC+3 skrev Raimo Suonio:

> Tässä ei ole kyse analogiasta vaan ihan aidosta tapauksesta. Alla on
> pätkä olemassa olevasta ihmisen geenistä ja sen mutatoituneesta
> muodosta. Esillä on 90 kirjainta, mutta geenissä on vielä noin 450
> kirjainta lisää; ne voidaan kuitenkin olettaa identtisiksi noiden
> kahden version välillä. Kyseinen mutaatio, joka oli luonnollisesti
> mukana Bergmanin metatutkimuksessakin, on esitetyn pätkän kirjaimessa
> 20. Ensimmäisessä versiossa se on A, toisessa T.
>
> ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC
> GTGGATGAAGTTGGTGGTGAGGCCCTGGGC...
>
> ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAAC
> GTGGATGAAGTTGGTGGTGAGGCCCTGGGC...
>
> En kerro, kumpi on alkuperäinen ja kumpi mutatoitunut muoto. En kerro
> myöskään, mistä geenistä on kyse, eli miten geeni näkyy ilmiasussa eli
> fenotyypissä. Jätän tämän fenotyyppi-tiedon kertomatta, koska
> Tarvonen vastikään kirjoitti näin: "Rappeutumista tai kehitystä ei
> mitata sillä, onko joku jotenkin mystisesti hyvä tai huono, vaan
> geneettisen informaation muutoksella."

Näppärä esimerkki, vaikeampaa tehdä helpommaksi ja silti säilyttää biologisen relevanssin.

(Kesti 30 sek selvittää mikä geeni, silloinhan tiesin mikä mutaatio
mutta ajoin vartausta silti, yllätyksekseni ilmeiseti posttranslaatiota
tapahtuu kun numerointi ei oikein täsmää? {ja halukkaille: ilmainen
työkalupakki kaikkeen tällaiseen löytyy osoitteesta expasy.org}

--
Kaj

Kaj Stenberg

unread,
Jun 25, 2018, 7:56:02 AM6/25/18
to
Den söndag 24 juni 2018 kl. 19:54:04 UTC+3 skrev Raimo Suonio:

> Tuo tieto ei paljon auta. Eivätkä auta myöskään Tarvosen hienot
> analogiat hiekkakasoista ja maitolaseista, joilla hän pyrki
> osoittamaan, ettei tarvitse tietää täsmällisiä määriä tietääkseen,
> mihin suuntaan määrä on muuttunut.

Tarvosen (ja Kettusen) analogioita vaivaa aina se että heti ensimmäisenä
jättävät elämän pois. Tällöin on tietenkin jopa oletettavaa että analogia
selittää huonosti kaikkea elämään liittyvää. Mikä tietenkin on se
biologisen evoluution pääpultti.

--
Kaj

Raimo Suonio

unread,
Jun 25, 2018, 9:09:38 AM6/25/18
to
Itse Kaj Stenberg virkkoi, noin nimesi:

> (Kesti 30 sek selvittää mikä geeni, silloinhan tiesin mikä
> mutaatio mutta ajoin vartausta silti, yllätyksekseni ilmeiseti
> posttranslaatiota tapahtuu kun numerointi ei oikein täsmää? {ja
> halukkaille: ilmainen työkalupakki kaikkeen tällaiseen löytyy
> osoitteesta expasy.org}

Tiesinhän minä, että sen voi helposti googlata esiin. Ja että
Tarvonenkin voisi sen tehtyään helposti sanoa, kummassa on [muka]
vähemmän informaatiota. Mutta siksi kirjoitinkin: "Minulle riittäisi,
että joku kreationisti kertoisi, miten yllä olevassa todellisessa
esimerkissä voidaan pätevän perustellusti päätellä geneettisen
informaation muutoksen suunta."

Sitä perustelua juuri etsin. Paras perustelu olisi tietenkin
matemaattinen, mutta kun Tarvonen nykyään tuntuu olevan sitä mieltä,
ettei matemaattista perustelua eli laskumenetelmää edes ole, niin jokin
muu pätevä perustelu käy myös. Paino sanalla "pätevä".

Kaj Stenberg

unread,
Jun 25, 2018, 11:50:50 AM6/25/18
to
Den måndag 25 juni 2018 kl. 16:09:38 UTC+3 skrev Raimo Suonio:
> Itse Kaj Stenberg virkkoi, noin nimesi:
>
> > (Kesti 30 sek selvittää mikä geeni, silloinhan tiesin mikä
> > mutaatio mutta ajoin vartausta silti, yllätyksekseni ilmeiseti
> > posttranslaatiota tapahtuu kun numerointi ei oikein täsmää? {ja
> > halukkaille: ilmainen työkalupakki kaikkeen tällaiseen löytyy
> > osoitteesta expasy.org}
>
> Tiesinhän minä, että sen voi helposti googlata esiin.

Oops, voiko tällaistakin nykään ihan (luotettavasti?) googlata.
Vanhasta muistista vaan käytin (kaikille ilmaista) ammattityövälinettä
expasy tools (ja joo, se on pelkkä portaali, mikäli halutaan nipottaa).

> Ja että
> Tarvonenkin voisi sen tehtyään helposti sanoa, kummassa on [muka]
> vähemmän informaatiota. Mutta siksi kirjoitinkin: "Minulle riittäisi,
> että joku kreationisti kertoisi, miten yllä olevassa todellisessa
> esimerkissä voidaan pätevän perustellusti päätellä geneettisen
> informaation muutoksen suunta."

> Sitä perustelua juuri etsin.

On kyllä kuin etsisit sitä kultaruukkua sateenkaaren loppupisteestä.
"Varmaa tietoa" siitä että joku on esittänyt sen sieltä löytyvän kyllä
löytyy. Mutta yritä sitten löytää hieman todellisemmin...

--
Kaj



Raimo Suonio

unread,
Jun 29, 2018, 5:01:08 PM6/29/18
to
Itse Raimo Suonio virkkoi, noin nimesi:

Kellään ei tunnu olevan mielipidettä. Kerronpa siis omani.

Kaikki nuo sukulinjat valloittavat hyvällä todennäköisyydellä koko
populaation. Todennäköisyys on "hyvä", koska uusi ominaisuus on
"selvästi hyödyllinen". Ja tämä ennuste perustuu siihen
evoluutioteoriaan, jossa satunnaiset mutaatiot tuottavat geneettistä
materiaalia ja luonnonvalinta suodattaa niistä vallitsevassa
ympäristössä hyödyllisintä materiaalia jatkoon.

Tietenkään jokainen noista sukulinjoista ei valloita sataa prosenttia
populaatiosta. Ne tekevät sen yhdessä. Koska luonnonvalinnan osuus
evoluutiosta sisältää paljon satunnaisuutta, absoluuttista
lopputulosta ei voi varmuudella ennustaa, vain todennäköisyyksiä voi
arvioida ja määritellä.

Tehtävänannon mukaan sukulinjat ovat sopeutuneisuudeltaan keskenään
melko lailla tasavertaisia, joten niiden keskinäinen jakautuminen
populaatiossa on pääosin sattumanvaraista. Joku niistä voi ajautua
jopa kokonaan pois populaatiosta, mutta oleellista on, että uuden
ominaisuuden haltijat valtaavat todennäköisesti populaation.

En tiedä mitään mekanismia tai syy-seuraus-suhdetta, joka antaisi
tehtävänannon mukaisten geneettisen informaation muutosten millään
tavoin vaikuttaa siihen, miten sukulinjat keskenään jakavat
populaatio-osuudet. Eikä minun tuntemani evoluutioteoria esitä siitä
mitään väitteitä.

Jos joku on sitä mieltä, että evoluutioteorian mukaan tehtävänannon
mukaisten muutosten geneettisen informaation määrässä pitäisi
vaikuttaa jotenkin lopputulokseen, olisi syytä myös esittää jotakin
konkreettista mielipiteensä tueksi.

Se, että ainoassa tuntemassamme evoluutiossa on geneettisen
informaation määrä paikallisesti jonkin verran lisääntynyt on
anekdootti eikä osoita evoluutioteoriasta mitään. Yhdestä ainoasta
havainnosta ei voi tehdä mitään yleistystä. Evoluutio prosessina on
herkkä lukuisille ympäristötekijöille, jotka voivat johtaa prosessin
arvaamattomille poluille. Geneettisen informaation lisääntyminen ei
ole mikään päämäärä evoluutioteorian kontekstissa.

Jos istutamme Marsin maaperään Maan maaperän mikrobeja, Marsiin tuskin
miljardissakaan vuodessa tulee mitään sen kummoisempaa elämää. Elämän
monimutkaisuus joko pysyy suunnilleen istutetulla tasolla tai putoaa
nollaan. Marsin tarjoamat resurssit ovat niin rajatut, että niitä
todennäköisesti voi hyödyntää sillä geneettisen informaation määrällä,
joka sinne istutettaisiin. Enemmästä ei olisi hyötyä.

Sen myönnän, että evoluutioprosessista mahdollisesti ja sopivissa
oloissa voi emergoitua informaation lisääntymistä. Maapallolla tuo
ilmiö on manifestoitunut, koska maapallo on laaja, siellä on
limittyneenä hyvin monenlaisia elinoloja ja ennen kaikkea tarjolla on
ollut riittämiin vettä ja energiaa.

Pitää muistaa, että mitä monimutkaisemmassa ekolokerossa eliö elää,
sitä enemmän se tarvitsee informaatiota selviytyäkseen. Jos sen
ympäristössä on tarjolla vielä käyttämätön, hyödyllinen resurssi ja se
mutaatioiden kautta saa informaatiota tuon resurssin käyttämiseen,
niin ominaisuus todennäköisesti vakiintuu populaatioon. Ja aina kun
jonkin eliölajin populaatio muuttuu uudenlaiseksi, se myös muuttaa, ja
mahdollisesti rikastaa, muiden vaikutusalueella olevien eliöiden
ympäristöä. Tästä syntyy emergenssi, biosfäärin ominaisuudet ovat
enemmän kuin eliöiden ominaisuuksien summa. Esimerkiksi ilman
lajirikkautta symbioosin hyödyntäminen olisi vähäistä tai olematonta.

Intellectually Superior

unread,
Aug 14, 2018, 3:04:58 AM8/14/18
to
Kaj Stenberg wrote:
> Den onsdag 6 juni 2018 kl. 22:34:52 UTC+3 skrev Pekka Ala-Mäyry:
>> Wed, 06 Jun 2018 10:38:06 +0300, TJT2 kirjoitti:
>
>>> Koska Kaj Stenberg tuntui eräässä ketjussa kiistävän koko
>>> informaation olemassaolon tai ainakin sen merkityksen. Hänellä kun
>>> on sellainen outo tapa heitellä jotain lyhyitä, epämääräisiä
>>> huonolla suomella kirjoitettuja tekstinpätkiä, sen asemesta että
>>> selittäisi kunnolla.
>>
>> Luulisin, että kyseessä on kvantitatiivisen informaation
>> määrä (ks. alla).
>
> Kirjoitusten perusteella näyttäisi aika selvältä ettei Tarvonen
> (edelleenkään) ymmärrä eroa kvantitatiivisen ja kvalitatiivisen
> välillä

Ymmärtääpäs, ja todennäköisesti paremmin kuin sinä. Tuo omituinen tapasi
tehdä JATKUVASTI virheellisiä spekulaatioita toisten henkilöiden osaamisesta
(toisessa ketjussa nolasit itsesi totaalisesti spekuloimalla Jerry Bergmanin
osaamattomuudella...) on taas eräs viite siihen, että sinun aivoissasi on
jotain pahasti vialla. Eräässä ketjussa kyselin jo koulu- ja
uravalinnoistasi suhteessa vanhempiisi, mutta palataan lapsuuteesi ja
kouluusi toisesta näkökulmasta: Miten pärjäsit peruskoulun ala- ja
yläasteella opettajiesi kanssa? Olitko kenties luokan häirikkö, jota
opettaja joutui ojentamaan jatkuvasti? Vai se luokan hiljaisin oppilas? Vai
jotain tuolta väliltä? Miten tulit toimeen luokkakavereittesi kanssa? Olitko
koulukiusaaja vai koulukiusattu??

--
--TJT--
Jos totuus loukkaa, on parempi että loukkaus tulee ilmi kuin että totuus
kätkettäisiin.
- St Jerome



Kaj Stenberg

unread,
Aug 14, 2018, 5:12:35 AM8/14/18
to
Den tisdag 14 augusti 2018 kl. 10:04:58 UTC+3 skrev Intellectually Superior:
Eräässä ketjussa kyselin jo koulu- ja
> uravalinnoistasi suhteessa vanhempiisi, mutta palataan lapsuuteesi ja
> kouluusi toisesta näkökulmasta: Miten pärjäsit peruskoulun ala- ja
> yläasteella opettajiesi kanssa? Olitko kenties luokan häirikkö, jota
> opettaja joutui ojentamaan jatkuvasti? Vai se luokan hiljaisin oppilas? Vai
> jotain tuolta väliltä? Miten tulit toimeen luokkakavereittesi kanssa? Olitko
> koulukiusaaja vai koulukiusattu??

Koita nyt hyvä mies saada elämäsi raiteille (mikäli joskus on ollut).
Ellei terveydenhoito ota vakavasti niin luulisi Mikkelin kokoisesta
kaupungissa löytyvän jotain vapaaehtoisvoimin toimivia terapiarinkejä
(ehkä jopa ilmaiseksi)?

--
Kaj

TJT2

unread,
Aug 15, 2018, 2:26:38 AM8/15/18
to
Kaj Stenberg wrote:
> Den tisdag 14 augusti 2018 kl. 10:04:58 UTC+3 skrev Intellectually
> Superior: Eräässä ketjussa kyselin jo koulu- ja
>> uravalinnoistasi suhteessa vanhempiisi, mutta palataan lapsuuteesi ja
>> kouluusi toisesta näkökulmasta: Miten pärjäsit peruskoulun ala- ja
>> yläasteella opettajiesi kanssa? Olitko kenties luokan häirikkö, jota
>> opettaja joutui ojentamaan jatkuvasti? Vai se luokan hiljaisin
>> oppilas? Vai jotain tuolta väliltä? Miten tulit toimeen
>> luokkakavereittesi kanssa? Olitko koulukiusaaja vai koulukiusattu??
>
> Koita nyt hyvä mies saada elämäsi raiteille (mikäli joskus on ollut).

Ei ole vastaus sinulle esitettyihin kysymyksiin. Kai sinä nyt sentään tuon
verran suomea osaat että ymmärrät mitä kysyttiin??

> Ellei terveydenhoito ota vakavasti niin luulisi Mikkelin kokoisesta

Länsi-Savossa (paikallinen sanomalehti) joku kohtalotoverini kirjoittaa
"Sano se" palstalla "Huono, huonompi ja huonoin. Kolme kokemusta Mikkelin
keskussairaalan lääkäreistä". (LS 14.8.2018, s.B12).

> kaupungissa löytyvän jotain vapaaehtoisvoimin toimivia terapiarinkejä
> (ehkä jopa ilmaiseksi)?

Jostain syystä minun postiluukustani kolisi edellämainitun lehden
edellämainittu numero KAHDESTI vaikka en edes ole kyseisen lehden tilaaja!
Vaan kerro nyt siitä lapsuudestasi ja nuoruudestasi. Oletko sinä käynyt
jossai terapiassa? Lähettikö opettajasi tai "terkkarisi" sinut sinne jo
kouluaikana, vai hakeuduitko itse joskus aikuisena, vai miten...?

--
--TJT--
Koska olen mulkku enkä koita saada vastapuolta omalle kannalleni, vaan
haluan vain vittuilla sille ja pilkata sille tärkeitä arvoja ja oppeja.
- JiiHoo, 19.8.2017



Kaj Stenberg

unread,
Aug 15, 2018, 6:15:24 AM8/15/18
to
Den onsdag 15 augusti 2018 kl. 09:26:38 UTC+3 skrev TJT2:
> Kaj Stenberg wrote:
> > Den tisdag 14 augusti 2018 kl. 10:04:58 UTC+3 skrev Intellectually
> > Superior: Eräässä ketjussa kyselin jo koulu- ja
> >> uravalinnoistasi suhteessa vanhempiisi, mutta palataan lapsuuteesi ja
> >> kouluusi toisesta näkökulmasta: Miten pärjäsit peruskoulun ala- ja
> >> yläasteella opettajiesi kanssa? Olitko kenties luokan häirikkö, jota
> >> opettaja joutui ojentamaan jatkuvasti? Vai se luokan hiljaisin
> >> oppilas? Vai jotain tuolta väliltä? Miten tulit toimeen
> >> luokkakavereittesi kanssa? Olitko koulukiusaaja vai koulukiusattu??
> >
> > Koita nyt hyvä mies saada elämäsi raiteille (mikäli joskus on ollut).
>
> Ei ole vastaus sinulle esitettyihin kysymyksiin. Kai sinä nyt sentään tuon
> verran suomea osaat että ymmärrät mitä kysyttiin??

No vastaapa sinä ensin kysymyksiin "mitä vittua asia sinulle kuuluu" ja
"miksi hemmetissä sinulle vastaisin"?

Lisäksi en usko että tarvitset vastauksia oikeastaan mihinkään
koskaan esitettyihin kysymyksiisi koska olet jo johtopäätöksesi
tehnyt jo siinä vaiheessa kun esität "kysymyksiäsi".

--
Kaj

TJT2

unread,
Aug 16, 2018, 5:34:58 AM8/16/18