Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

MVlehden paluuta odotellassa faktaa evoharhasta

205 views
Skip to first unread message

TJT2

unread,
Jan 12, 2018, 3:54:34 AM1/12/18
to
Eräs presidenttiehdokas näyttää väittävän vaalikoneessa, että tieteen
tarjoama selitys elämän synnylle (siis abiogeneesi) on parempi kuin Raamatun
selitys. Kovin erikoinen lausunto, kun eihän teillä evouskovilla ole mitään
selitystä vaan iso kasa erilaisia abiogeneesihypoteeseja. Hypoteesihan on
lähinnä selitysYRITYS, ja kun on olemassa monta erilaista, keskenään
ristiriitaista hypoteesia, ei tietenkään voi olla yhtä ainoaa selitystä.
Tieteen tarjoaminen selitysten lukumäärä on siis NOLLA, ja nolla ei
tietenkään voi olla parempi kuin Raamatun YKSI selitys.

Evousko siis kaatuu jo abiogeneesiin, mutta tarkastellaan nyt sitä
varsinaista evo-oppia, siis biologista evoteoriaa. Sehän voidaan
yksinkertaistaa matemaattiseen yhtälöön
Evoluutio = Mutaatio + Luonnonvalinta, lyhyemmin E = M + L.
Näyttää kovin yksinkertaiselta ja selvältä asialta, mutta toisinaan asiat
eivät ole sitä miltä näyttävät. Itseasiassa tuossa failaa sekä M että L,
joten E failaa totaalisesti. Mutaatiot, myös ne ns. hyödylliset, aiheuttavat
geneettistä rappeutumista. Evoluutioteorian edellyttämiä geneettistä
informaatiota lisääviä mutaatioita ei näytä oikeasti olevan edes olemassa,
tai jos on, niin ovat niin superhyperharvinaisia, että niitä ei ole
ollenkaan riittävästi. Jos evo olisi totta, tällaisia mutaatioita pitäisi
olla joka paikka täynnä. Luonnonvalinta EI KOHDISTU yksittäisiin
mutaatioihin, vaan se kohdistuu aina yksilöihin, siis koko pakettiin. Joten
vaikka jossain olisikin joku evon edellyttämä kehitysmutaatio, sen mukana
tulee "kaupanpäällisenä" valtava määrä rappeuttavia mutaatiota, ja näinollen
nettosaldo miinuksella.

Professori Sandord on käsitellyt tätä aihetta perusteellisesti kirjassaan
Genetic entropy and mystery of genome, joka on suomennettu nimellä
Eliömaailma rappeutuu
http://www.intelligentdesign.fi/2016/02/09/kirja-arvio-eliomaailma-rappeutuu-empiirista-tietoa-evoluutiomekanismista/

Myös Dr. Lee M. Spetner näyttää kirjoittaneen uuden kirjan, "The Evolution
Revolution - Why Thinking People are Rethinking the Theory of Evolution",
itselläni on se vanha kirja "NOT by Change! Shattering the modern theory of
Evolution", joka sekin on aika kovaa kamaa.

Joten kiireesti lähimpään kirjakauppaan ostamaan, tai antamaan kritiikkiä
jos näitä merkkiteoksia ei löydy valikoimasta. Kuluttajaa palvelevat kaupat
tosin yleensä tilaavat, jos ei löydy hyllystä. Ja voihan näitä tilata
suoraan netistäkin.

--
--TJT--
The only thing that appears to be evolving is 'evolution,' and it's becoming
more and more absurd.


---
This email has been checked for viruses by AVG.
http://www.avg.com

JiiHoo

unread,
Jan 12, 2018, 4:37:05 AM1/12/18
to
TJT2 has brought this to us :
> Eräs presidenttiehdokas näyttää väittävän vaalikoneessa, että tieteen
> tarjoama selitys elämän synnylle (siis abiogeneesi) on parempi kuin Raamatun
> selitys.

Vitut, minä en tähän jaksa ottaa kiinni.

Mutta itseäni hämmästyttää, että poliitikon kuitenkin pitäisi olla
uskovainen, mutta ei tunnusta uskoa. Jotenkin kovin kummallinen
asetelma.

Muistan hyvin senkin kuinka Paavo Lipponenkin liittyi takaisin
kirkkoon, koska pääministeri ei voi olla eronnut siitä. Ja joskus
aikoinaan kaikki pressaehdokkaat julistivat jotain uskoaan ja Elisabeth
Rehn joutui oikein piinapenkkiin, kun oli erehtynyt sanomaan jotain
Jeesuksesta.

Nyt ollaan edetty siihen, että yksikään pressaehdokas ei todellakaan
julista ettei usko mihinkään ja uskonnot ovat perseestä. Täytyy siis
edelleen uskoa, mutta sillai salaa ja huomaamattomasti. Mutta yhtä
ehdokasta hiillostetaan, koska se uskoo ihan oikeasti eikä vaan sillai
leikisti.

Todella kummallisen jakomielitautista touhua.

--
Unelmoin monikulttuurisuuskuplan räjähtämisestä miljooniksi
sirpaleiksi.

Matti Lehtiniemi

unread,
Jan 12, 2018, 5:06:38 AM1/12/18
to
> Evoluutio = Mutaatio + Luonnonvalinta, lyhyemmin E = M + L.

Luin eka Evoluutio = (M)atti + (L)ehtiniemi, mutta veikkaan että tämä on
vain minun oma tulkintani.

> niitä ei ole ollenkaan riittävästi. Jos evo olisi totta, tällaisia
> mutaatioita pitäisi olla joka paikka täynnä. Luonnonvalinta EI KOHDISTU

Onhan niitä mutaatioita kaikki paikat täynnä.Senhän näkee jo siitä, että
me ollaan kaikki eri näköisiä.
Yhden pariskunnan lapset ovat eri näköisiä, elleivät ole identtisiä
kaksosia.

Tämä evoluutio on vaan niin vaikea ymmärtää, kun se on tapahtunut
vuosimiljoonien kuluessa.Sen sijaan nykyihmisen kehitys on tapahtunut
muutamassa tuhannesssa vuodessa.
Me ollaan muututtu kokonaan erilaiseksi olennoksi siitä apinasta,mistä
me ollaan kehitytty.Jopa niin erilaiseksi , että koemme olevamme jotain
muuta kuin "eläimet".Eli olemme keksineet jopa sanan kuvaamaan muita
kuin itseämme.

Matti

Otto J. Makela

unread,
Jan 12, 2018, 7:24:25 AM1/12/18
to
Matti Lehtiniemi <matti.le...@remove-me.kolumbus.fi> wrote:

> Tämä evoluutio on vaan niin vaikea ymmärtää, kun se on tapahtunut
> vuosimiljoonien kuluessa.Sen sijaan nykyihmisen kehitys on tapahtunut
> muutamassa tuhannesssa vuodessa.

*sadassa tuhannessa vuodessa.

Within the Hominoidea (apes) superfamily, the Hominidae family
diverged from the Hylobatidae (gibbon) family some 15–20 million
years ago; African great apes (subfamily Homininae) diverged
from orangutans (Ponginae) about 14 million years ago; the
Hominini tribe (humans, Australopithecines and other extinct
biped genera, and chimpanzee) parted from the Gorillini tribe
(gorillas) between 9 million years ago and 8 million years ago;
and, in turn, the subtribes Hominina (humans and biped
ancestors) and Panina (chimps) separated about 7.5 million years
ago to 5.6 million years ago.
-- https://en.wikipedia.org/wiki/Human_evolution

Followup-to: sfnet.keskustelu.evoluutio
--
/* * * Otto J. Makela <o...@iki.fi> * * * * * * * * * */
/* Phone: +358 40 765 5772, ICBM: N 60 10' E 24 55' */
/* Mail: Mechelininkatu 26 B 27, FI-00100 Helsinki */
/* * * Computers Rule 01001111 01001011 * * * * * * */

Matti Lehtiniemi

unread,
Jan 12, 2018, 7:59:11 AM1/12/18
to
> *sadassa tuhannessa vuodessa.

Sehän on toki määrittelykysymys mikä on ihminen ja mikä eläin.Kun me
itse ihmiset ollaan määrittelemssä asiaa, voidaan me tehdä se miten me
halutaan.

Jopa minä muistan vielä ajan, jolloin eläimiä pelättiin ja
vihattiin.Majavia erityisesti, ne olivat kilpailjoita.

Nykyään (suomalainen) ihminen on jo ihan totaalisesti jotain muuta kuin
eläin.

Jos omana mutu-arviona pitää sanoa, niin kehitys ihmiseksi alkoi noin
100 000 vuotta sitten.Mielestäni se tapahtui jossain Intian alueella.
Kun kerran olin Phuketissa, tuli aivan maaginen olo.Ihan eri kuin
Bangkokissa.Tuntui että juuri tänne minä olen syntynyt.

Mä väittäisin että joskus 30 000 vuotta sitten Intia oli keskuspaikka,
jonne ihmiset kokoontuivat asutusta maailmasta.Jos ihminen oli
kehityskelpoinen ja kyvykäs, muutti hän sinne.Oppimaan elämää ja
maailmaa muilta ihmisiltä.

Uskoisin että noista ajoista on jäljellä legenda Shangri La:sta ja
Puntin maasta.
Sekä tietysti Intian rikas kulttuuri.
Shambala(Shangri La) on ollut _itse_ Intia, ei mikään myyttinen
kuningaskunta.

Matti

TJT2

unread,
Jan 14, 2018, 9:48:59 AM1/14/18
to
Matti Lehtiniemi wrote:
>> niitä ei ole ollenkaan riittävästi. Jos evo olisi totta, tällaisia
>> mutaatioita pitäisi olla joka paikka täynnä. Luonnonvalinta EI
>> KOHDISTU
>
> Onhan niitä mutaatioita kaikki paikat täynnä.Senhän näkee jo siitä,

Viittaako "niitä" nyt mainitsemiini "tällaisiin"? Mutaatioita on toki
valtavasti, mutku ne eivät ole "tällaisia". Lue se prof. Sanfordin kirja,
tai katso edes se antamani linkki jossa asia on selitetty lyhyesti. Siis
evoteoria aka kehitysoppi edellyttää kehitysmutaatioita, ei se evo toimi
millä tahansa mutaatiolla, muutoksella on aina suunta.

> että me ollaan kaikki eri näköisiä.

Jäikö sinulta koulussa biologia kokonaan opiskelematta? Ihmisten
erinäköisyys johtuu REKOMBINAATIOISTA. Tai jos tarkkoja ollaan, pääosin
rekombinaatioista ja pienenpieneltä osin niistä evoteorian vastaisista
rappeuttavista mutaatioista.

> Yhden pariskunnan lapset ovat eri näköisiä, elleivät ole identtisiä
> kaksosia.

Niin, etkö todellakaan tunne käsitettä "rekombinaatio"?

> Tämä evoluutio on vaan niin vaikea ymmärtää, kun se on tapahtunut
> vuosimiljoonien kuluessa.Sen sijaan nykyihmisen kehitys on tapahtunut

Niin, joidenkin evotiedemiesten mukaan evo todellakin on niin hidasta, että
ei sitä voi nähdä, vaan pitää töllistellä fossiileja. Ja samaan aikaan eräät
toiset evotiedemiehet julistavat suu vaahdossa kuinka näkevät omin silmin
kuinka sitä evoa tapahtuu sekä koeputkessa että luonnossa. Nykyihminen ei
ole kehittynyt, nykyihminen on rappeutunut.

> muutamassa tuhannesssa vuodessa.

Otto näyttää jo ojentaneen sinua noista vuosista.

> Me ollaan muututtu kokonaan erilaiseksi olennoksi siitä apinasta,mistä

Otto ei näytä ojentaneen sinua tuosta apinasta, eikä kukaan muukaan, mutta
pistän silti
http://personal.inet.fi/koti/tjt/evsfnykyape.html
kun tämä stenberien sekoilu jotenkin jaksaa edelleenkin huvittaa minua.

> me ollaan kehitytty.Jopa niin erilaiseksi , että koemme olevamme

Miten rappeuttavien mutaatioiden avulla voi kehittyä?? Keitätkö sinä kahvia
ruiskuttamalla kahvipannuasi nestemäisellä typellä?? Meilläpäin kahvipannu
laitetaan kuumalle hellalle. Meilläpäin kun ymmärretään, että muutoksella on
suunta, ja pitää valita OIKEA suunta halutun lopputuloksen saavuttamiseksi.

> jotain muuta kuin "eläimet".Eli olemme keksineet jopa sanan kuvaamaan
> muita kuin itseämme.

Niin, vilkkaalla mielikuvituksella keksii vaikkapa 7 kaasukammiota
Majdanekiin, joskus vuoden 2005 tienoilla kyseisen holohölömuseon johtaja
lopulta nöyrtyi sen verran tieteellisten todisteiden edessä, että myönsi
että 5 näistä seitsemästä kammiosta ei olekaan kaasusammioita. Evoluution
uskovilla sen sijaan on vielä opeteltavaa tuon tieteellisten todisteiden
edessä nöyrtymisen kanssa.

--
--TJT--
The Edge of Evolution makes it much more difficult for an atheist to find
fulfillment in Darwin.

Matti Lehtiniemi

unread,
Jan 14, 2018, 11:36:33 AM1/14/18
to
> Niin, etkö todellakaan tunne käsitettä "rekombinaatio"?

Piti ihan lukea tuo termi wikipediasta.Minun lapsuudessani en törmännyt
tuohon termiin biologian kirjoissa.
Jaa, ovatko uskovaiset keksineet tämän termin todistamaan itsellensä,
ettei ihminen ole kehittynyt apinasta ?
Eli että ihmisen kromosomiluku olisi pysynyt samana maailman luomisesta
saakka ?
No oikei, ymmärrän nyt mitä ajat takaa.Minun näkemykseni mukaan
kromosomien lukumäärä eliöillä nousee/laskee mutaatioiden ansiosta.
Tosiaan, itse lapsen ulkonäkö määräytynee erilaiseksi ilman
mutaatioitakin.Tuon rekombinaatiosi ansiosta.
Mutaatioiden määrän ihmisessähän voi arvioida siitä, miten paljon kaksi
identtistä kaksosta eroaa fyysisesti toisistaan.

Ihmisen evoluutio on siis kombinaatio: rekombinaatio + mutaatio.
Mutaatiota tarvitaan siinä hypyssä kun uusi eläinlaji syntyy.

> Otto näyttää jo ojentaneen sinua noista vuosista.

Ei Otto minua ojentanut siinä mitenkään.Vaan se mikä määritellään
"ihmiseksi" on meidän ihmisten itsemme määriteltävissä kun tällä
planeetalla ei ole ketään vahvempaa olentoa kuin me määrittelemääsä meitä.
Se voi olla se ihmisapina mikä oli 2 miljoonaa vuotta sitten,tai se mikä
oli 100 000 vuotta sitten, tai vaikka teidän uskovaisten 7000 vuotta
sitten, jolloin raamatun mukaan maailma luotiin.

Minun käsityksen mukaan nykyihminen muodostui Egyptissä, eli Raamatun
määritelmä on se suunnilleen sama.
Ihminen valjasti suuret jokilaaksot ruoan-tuotantoon, lisääntyi kuin
kani, ja muutaman vuosituhannen aikana keksi ne keksinnöt, jotka
määrittelevät nykyihmisen.(pronssi, rauta, pyörä, laivat)
Meidän psyyke muuttui ihmisen psyykkeeksi siitä ihmis-eläimestä, mitä me
aiemmin olimme.

> Miten rappeuttavien mutaatioiden avulla voi kehittyä?? Keitätkö sinä
> kahvia ruiskuttamalla kahvipannuasi nestemäisellä typellä?? Meilläpäin

Yksi kymmenestä miljoonasta mutaatiosta osoittautuu hyödylliseksi.Se
toki vaatii sitä, että kyseisen mutaation saanut eläin/ihminen osaa
käyttää hyödykseen kyseistä mutaatiota.

Matti

Kaj Stenberg

unread,
Jan 14, 2018, 12:35:42 PM1/14/18
to
Den söndag 14 januari 2018 kl. 18:36:33 UTC+2 skrev Matti Lehtiniemi:
> > Niin, etkö todellakaan tunne käsitettä "rekombinaatio"?
>
> Piti ihan lukea tuo termi wikipediasta.Minun lapsuudessani en törmännyt
> tuohon termiin biologian kirjoissa.
> Jaa, ovatko uskovaiset keksineet tämän termin todistamaan itsellensä,
> ettei ihminen ole kehittynyt apinasta ?

Ei, kyllä se on ihan tieteellinen termi havaitulle mekanismille. Taisi
tulla koulukirjoihin 1980 luvun vaihteessa?

> Eli että ihmisen kromosomiluku olisi pysynyt samana maailman luomisesta
> saakka ?
> No oikei, ymmärrän nyt mitä ajat takaa.Minun näkemykseni mukaan
> kromosomien lukumäärä eliöillä nousee/laskee mutaatioiden ansiosta.

No, kromosomimuutaation joissa kromosomien lukumäärä laskee taikka
nousee ovat harvinaisia (on niitäkin). Polyploidia kasveissa toki
jopa yleistä ja helposti toistettavissa. Yleisempiä ovat kromosomien
sisällä suuret muutokset, silloin lukumäärä on sama. Yleensä eivät
kovin elinvoimaisia (kasvit täysin eri juttu)

_PALJON_ yleisempiä on n.s. geenimutaatiot, niitä tulee tuhansia
sukupolvesta toiseen.

_Lajiutuminen_ sitten voi syntyä joko niin että (iso) mutaatio
muodostaa välittömän lisääntymskuilun sukupolvesta toiseen, _taikka_
niin että ei-geneettinen este eristää kaksi populaatiota toisistaan
ja ne ajan myötä muodostavat eri lajeja.

> Ihmisen evoluutio on siis kombinaatio: rekombinaatio + mutaatio.
> Mutaatiota tarvitaan siinä hypyssä kun uusi eläinlaji syntyy.

Ihmisen joo. Bakteereilla taas on melko tehoton "rekombinaatio"mekanismi, joten niissä havaitut mutaatiot ovat pitkälti geenimutaatioita.

[..]

> Minun käsityksen mukaan nykyihminen muodostui Egyptissä, eli Raamatun
> määritelmä on se suunnilleen sama.

Miksi juuri Egyptissä (Luxor?) eikä sitä vanhemmissa löydetystä
sivilisaatioissa ja kaupungeissa?

Itse laittaisin "ihmisen synty" siihen tapahtumaan kun meidän kromosomi
nro 2 muodostui liittämällä kaksi kromosomia yhdeksi.

--
Kaj

Matti Lehtiniemi

unread,
Jan 14, 2018, 5:18:08 PM1/14/18
to
> Ei, kyllä se on ihan tieteellinen termi havaitulle mekanismille. Taisi
> tulla koulukirjoihin 1980 luvun vaihteessa?

Olisiko tullut vähän jälkeenpäin kun minä en muista.Itse olen ajatellut
aina että mutaatiot ja rekombinaatio on sitä samaa mutaatiota mutta
ymmärrän kyllä nyt että rekombinaatio voidaan määritellä täysin eri
asiaksi kuin mutaatio.

Minulle opetettiin asia niin että DNA on kuin vetoketju, toinen puolisko
tulee isältä ja toinen äidiltä.Sitten se vedetään yhteen.

Suoraan sanottuna en ole erityisen kiinnostunut tästä asiasta ja uskon
hyvin ,että varsinkin sinä tiedät asian paljon minua paremmin.
En edes tarkkaan muista mikä kromosomi on.

Jos ihmisellä on 21000 geeniä ja mehiläisellä 15000 , niin uskon hyvin
että niiden määrä on luovasti noussut tai laskenut vuosimiljoonien
kuluessa.(tietysti enemmän noussut)
Näiden asioiden tutkiminen vaatisi merkittävästi enemmän aikaa ja
resursseja kuin mihin minä olen valmis.

> Miksi juuri Egyptissä (Luxor?) eikä sitä vanhemmissa löydetystä
> sivilisaatioissa ja kaupungeissa?

Ihan mutu-fiiliksenä.Ihan niin kuin raamatussa on oma mutu-juttu tästä
asiasta.Joskus lapsena tuntui siltä että Egypti oli jotain maagista,
poikkeuksellista.

Kun keinokastelu mahdollisti ihmisten hurjan lisääntymisen, tuli
ihmisten elämästä aivan erilaista kuin aikaisemmin.
Toisin sanoen syntyi ihan kuin kokonaan uusi laji, vaikka fyysisesti
ihminen ei juurikaan muuttunut.Ei ainakaan geneettisesti.
Siksi tämän krea-porukan maailmankuva on jossain määrin ymmärrettävä.
Ihminen erityi aivan omaksi jutukseen, erilleen muusta eläinkunnasta.

Vähän kuin meidän elämä on muuttunut.En minä lapsena isän kanssa
kalastaessa ja metsästysretkillä ajatellut että aikuisena em. asioiden
merkitys olisi lähellä nollaa.Ei meidän perheessä näiden asioiden
merkitys ollut iso 70-luvulla, mutta sentään niillä oli joku merkitys.

Matti

Ari Saastamoinen

unread,
Jan 14, 2018, 7:11:34 PM1/14/18
to
"TJT2" <truth.i...@atheism.is.invalid> writes:

> Meilläpäin kahvipannu laitetaan kuumalle hellalle. Meilläpäin kun
> ymmärretään, että muutoksella on suunta, ja pitää valita OIKEA
> suunta halutun lopputuloksen saavuttamiseksi.

Paitsi että luonnon evoluutiossa ei ole olemassa mitään haluttua
lopputulosta. Evoluutiolla ei ole ollut mitään tavoitetta saada
aikaan ihmistä, ja yhdestä sukuhaarasta nyt vain on sattunut tulemaan
tällainen. Ainoastaan se on merkityksellistä, että pärjääkö olio
ympäristössään.

--
Arzka oh3mqu+...@hyper.fi - En halua follareita mailina
1. Valitse sopiva paikka, ei ihmisten tai rakennusten lahella, jossa
paukku voi aiheuttaa hairiota. - Iso-Kiinalaisen kayttoohje

Tuomas Yrjövuori

unread,
Jan 15, 2018, 5:25:40 AM1/15/18
to
Ari Saastamoinen kirjoitti 15.01.2018 klo 02:11:
> Paitsi että luonnon evoluutiossa ei ole olemassa mitään haluttua
> lopputulosta.

Periaatteessa olet aivan täysin oikeassa, mutta - tämä nyt on vain
tällaista omaa höpinääni - jos puhutaan "halutusta" tai "ei-halutusta
lopputuloksesta", sisältyy siihen oletus, että on olemassa joku tai
jokin, joka haluaa tai ei halua.

Tuosta syystä mielestäni ei voida puhua sen paremmin halutusta kuin
ei-halutustakaan lopputuloksesta. Tai vähintäänkin pitäisi määritellä se
persoona. Voiko evoluutiolle antaa persoonan? Voidaanko sanoa "evoluutio
haluaa"?

> Evoluutiolla ei ole ollut mitään tavoitetta saada
> aikaan ihmistä, ja yhdestä sukuhaarasta nyt vain on sattunut tulemaan
> tällainen.

Sattuman käsite on mielestäni myöskin ongelmallinen. Entäpä sitten
evoluution suunta, onko sellaista? Ehdottomasti on, ja on aina ollut.
Tähän saakka se suunta on ollut nykyhetkeä kohti. Tällä hetkellä se
suunta on kohti vaikeasti määriteltävää tulevaisuutta.

> Ainoastaan se on merkityksellistä, että pärjääkö olio
> ympäristössään.

Ja se ympäristö koostuu myös muista olioista, eliöistä, monimutkaisista
symbiooseisesta ja kulttuurievoluution luomista järjestelmistä.

--
Tuomas Yrjövuori

Tuomas Yrjövuori

unread,
Jan 15, 2018, 5:33:36 AM1/15/18
to
Tuomas Yrjövuori kirjoitti 15.01.2018 klo 12:25:
> Tuosta syystä mielestäni ei voida puhua sen paremmin halutusta kuin
> ei-halutustakaan lopputuloksesta. Tai vähintäänkin pitäisi määritellä se
> persoona. Voiko evoluutiolle antaa persoonan? Voidaanko sanoa "evoluutio
> haluaa"?

Tämän voisi ehkä kiteyttää: Evoluutio vastaa kysymykseen "miten". Se ei
vastaa kysymykseen "kuka tai mikä".

--
Tuomas Yrjövuori

John Smith

unread,
Jan 15, 2018, 7:20:27 AM1/15/18
to
Ånkå ihan pakkå paskantaa venttiiliinkin, håmå?

--
uʍop ǝpᴉs sᴉɥʇ

Timo Pietilä

unread,
Jan 15, 2018, 7:21:07 AM1/15/18
to
Evoluutio on pikemminkin "mitä" ja evoluutioteoria sitten vastaa
kysymykseen "miten".

Timo Pietilä

Lume Laipio

unread,
Jan 15, 2018, 7:56:37 AM1/15/18
to

"John Smith"
> Tuomas Yrjövuori wrote:

>>> Ainoastaan se on merkityksellistä, että pärjääkö olio
>>> ympäristössään.
>>
>> Ja se ympäristö koostuu myös muista olioista, eliöistä, monimutkaisista
>> symbiooseisesta ja kulttuurievoluution luomista järjestelmistä.

> Ånkå ihan pakkå paskantaa venttiiliinkin, håmå?

Venttiilissä on evoluutio pysähtynyt.


TJT2

unread,
Jan 15, 2018, 8:04:28 AM1/15/18
to
Matti Lehtiniemi wrote:
>> Niin, etkö todellakaan tunne käsitettä "rekombinaatio"?
>
> Piti ihan lukea tuo termi wikipediasta.Minun lapsuudessani en
> törmännyt tuohon termiin biologian kirjoissa.

Kyseistä termiä on käytetty ahkerasti täällä sfnetissäkin.

> Jaa, ovatko uskovaiset keksineet tämän termin todistamaan itsellensä,
> ettei ihminen ole kehittynyt apinasta ?

En löytänyt sanan alkuperää pikaisella "googlauksella", mutta eräällä
sivulla mainitaan vuosiluku 1791, ja eräällä toisella puhutaan
kosmologiasta, jossa myös näköjään tunnetaan kyseinen termi. Kaj Stenberg
osannee selittää, kuka, missä, milloin, miksi otti käyttöön kyseisen termin
evobiologiassa!?

> Eli että ihmisen kromosomiluku olisi pysynyt samana maailman
> luomisesta saakka ?

Niin, Aadamilla ja Eevalla oli ihmisen kromosomisto,

> No oikei, ymmärrän nyt mitä ajat takaa.Minun näkemykseni mukaan
> kromosomien lukumäärä eliöillä nousee/laskee mutaatioiden ansiosta.

Täällä sfnetissä on toisinaan todella vaikea olla varma, onko vastapuoli
ihan tosissaan sekaisin vai trollaako se. Mitenkä muuten se kromosomien
lukumäärä voisi muuttua, kun kromosomistomutaatio nimenomaan on kromosomien
lukumäärän muuttumista.
https://fi.wikipedia.org/wiki/Kromosomistomutaatio
Tätä ei sitten pidä sekoittaa kromosomimutaatioon
https://fi.wikipedia.org/wiki/Kromosomimutaatio
eikä pistemutaatioon
https://fi.wikipedia.org/wiki/Pistemutaatio
joka on evoluutiouskonnon (evoluutiouskontosi) mukaan se oleellisin.

> Tosiaan, itse lapsen ulkonäkö määräytynee erilaiseksi ilman
> mutaatioitakin.Tuon rekombinaatiosi ansiosta.

Olethan nyt kiitollinen kun opetin sinulle jotain uutta ja ihmeellistä!?

> Mutaatioiden määrän ihmisessähän voi arvioida siitä, miten paljon
> kaksi identtistä kaksosta eroaa fyysisesti toisistaan.

Ei todellakaan voi.

> Ihmisen evoluutio on siis kombinaatio: rekombinaatio + mutaatio.
> Mutaatiota tarvitaan siinä hypyssä kun uusi eläinlaji syntyy.

Ei tarvita, ainakaan jos "uudella" tarkoitetaan kladogeneesin kautta
syntyneitä lajeja
https://en.wikipedia.org/wiki/Cladogenesis
Anageneesi on sitten eri asia. Juuri tässä(kin) evolutionismi menee metsään.

>> Otto näyttää jo ojentaneen sinua noista vuosista.
>
> Ei Otto minua ojentanut siinä mitenkään.Vaan se mikä määritellään

Ainakin näytti yrittäneen opettaa sinulle evoluutiouskontosi "totuuksia".

> "ihmiseksi" on meidän ihmisten itsemme määriteltävissä kun tällä
> planeetalla ei ole ketään vahvempaa olentoa kuin me määrittelemääsä
> meitä. Se voi olla se ihmisapina mikä oli 2 miljoonaa vuotta
> sitten,tai se mikä oli 100 000 vuotta sitten, tai vaikka teidän
> uskovaisten 7000 vuotta sitten, jolloin raamatun mukaan maailma
> luotiin.

Niin, ylimääräinen C14 ja yli 100 muuta todistetta osoittavat aika selvästi,
että maapallon ikä lasketaan tuhansissa eikä miljoonissa vuosissa,
miljardeista puhumattakaan.

> Minun käsityksen mukaan nykyihminen muodostui Egyptissä, eli Raamatun
> määritelmä on se suunnilleen sama.

Onko sinulla jotain tieteellistä faktaakin käsityksesi tueksi?

> Ihminen valjasti suuret jokilaaksot ruoan-tuotantoon, lisääntyi kuin
> kani, ja muutaman vuosituhannen aikana keksi ne keksinnöt, jotka

Niin, ei siihen miljoonia vuosia tarvita, exponentiaalinen väestönkasvu jne.

> määrittelevät nykyihmisen.(pronssi, rauta, pyörä, laivat)
> Meidän psyyke muuttui ihmisen psyykkeeksi siitä ihmis-eläimestä, mitä
> me aiemmin olimme.

Emme olleet.

>> Miten rappeuttavien mutaatioiden avulla voi kehittyä?? Keitätkö sinä
>> kahvia ruiskuttamalla kahvipannuasi nestemäisellä typellä??
>> Meilläpäin
>
> Yksi kymmenestä miljoonasta mutaatiosta osoittautuu hyödylliseksi.Se

En jaksa tarkistaa, kun tuntuu olevan suurinpiirtein oikea suuruusluokka. Ja
juuri tämä pieni määrä on se ongelma. Siis ongelma teille evolutionisteille.

> toki vaatii sitä, että kyseisen mutaation saanut eläin/ihminen osaa
> käyttää hyödykseen kyseistä mutaatiota.

Trollaati trollaati trollallei...!? Hyödyllisen mutaation määritelmän
mukaan se tapahtuu automaagisesti. Ja kuten jo totesin, hyödyllinenkin
mutaatio voi rappeuttaa. Siis ihan yksinäänkin, ja sitten täytyy tietysti
ottaa huomioon, kuten jo totesin, että valinta ei kohdistu yksittäiseen
mutaatioon vaan koko eläimeen. Tai koko kasviin. Tai koko sieneen tai mitä
kuntaa se eliö onkaan.

--
--TJT--
Atheists will never be satisfied because they are not seeking truth, they
are seeking to guard a paradigm.

TJT2

unread,
Jan 15, 2018, 8:04:28 AM1/15/18
to
No jos se evoluutio osaa vastata kysymykseen, niin miksei se sitten kirjoita
sitä vastauta tänne sfnettiin? Tai joku teistä evolutionisteista kyseisen
evoluution puolesta, jos se itse ei uskalla!? Siis vastaus kysymykseen
"MITEN rappeuttavilla mutaatioilla saadaan aikaan rappeutumiselle
vastakkaista kehitystä?"

--
--TJT--
The only thing that appears to be evolving is 'evolution,' and it's becoming
more and more absurd.



TJT2

unread,
Jan 15, 2018, 8:04:28 AM1/15/18
to
Ari Saastamoinen wrote:
> "TJT2" <truth.i...@atheism.is.invalid> writes:
>
>> Meilläpäin kahvipannu laitetaan kuumalle hellalle. Meilläpäin kun
>> ymmärretään, että muutoksella on suunta, ja pitää valita OIKEA
>> suunta halutun lopputuloksen saavuttamiseksi.
>
> Paitsi että luonnon evoluutiossa ei ole olemassa mitään haluttua
> lopputulosta. Evoluutiolla ei ole ollut mitään tavoitetta saada

Niin, mutta kahvipannuesimerkkini toimii silti, korvataan vain haluttu
toteutuneella. Siis "toteutuneella".

> aikaan ihmistä, ja yhdestä sukuhaarasta nyt vain on sattunut tulemaan
> tällainen. Ainoastaan se on merkityksellistä, että pärjääkö olio
> ympäristössään.

Eipäs ole, jos tarkastelemme prosessia (jota te tässä tapauksessa väitätte
toteutuneeksi historiaksi) siitä mystisestä alkukopioitujasta nykyihmiseen.
Jos otamme alkukopioitujan ja räiskimme mitä tahansa mutaatioita, tuloksena
on todennäköisemmin kuollut kopioituja kuin elävä ihminen, ja vielä
varmemmin saamme kuolleen kopioitujan jos räiskimme siihen vain rappeuttavia
mutaatioita. (tai ainakin tästä kopioitujasta lähtevä sukulinja päätyy
sukupuuttoon jo kauan ennen kuin saadaan edes niitä maalle pomppivia
kaloja...)

Kaj Stenberg

unread,
Jan 15, 2018, 8:26:46 AM1/15/18
to
Den måndag 15 januari 2018 kl. 00:18:08 UTC+2 skrev Matti Lehtiniemi:
> > Ei, kyllä se on ihan tieteellinen termi havaitulle mekanismille. Taisi
> > tulla koulukirjoihin 1980 luvun vaihteessa?
>
> Olisiko tullut vähän jälkeenpäin kun minä en muista.Itse olen ajatellut
> aina että mutaatiot ja rekombinaatio on sitä samaa mutaatiota mutta
> ymmärrän kyllä nyt että rekombinaatio voidaan määritellä täysin eri
> asiaksi kuin mutaatio.

Kaikki opettajat painottavat hieman eri asioita (minun bilsan opettaja piti perinnöllisyystiedettä tärkeänä, oli muuten uskovainen).

Mutta kun meioosista sait kuulla että "homologiset kromosomit asettuvat rinnakkain ja sattuu crossing over" niin tulos on juuri tuo rekombinaatio, vaikka ei ehkä sitä termiä käytetty.

--
Kaj

Lume Laipio

unread,
Jan 15, 2018, 10:36:17 AM1/15/18
to

"TJT2"
> Matti Lehtiniemi :


>> Minun käsityksen mukaan nykyihminen muodostui Egyptissä, eli Raamatun
>> määritelmä on se suunnilleen sama.
>
> Onko sinulla jotain tieteellistä faktaakin käsityksesi tueksi?


Fakta on aina tieteellistä. Ei se muuten faktaa olisikaan.
Toisin kuin esim. Raamatun tai Kalevalan legendat ensimmäisen
ihmisen syntymästä. Niillä ei ole mitään faktapohjaa, kuten
kaikki suht. normaalit sen tajuavat.
Raamattua ei ole syytä käyttää luonnontieteen lähdeteoksena.
Hyviä moraalisia neuvoja sieltä kyllä saa. Tutustuisit niihin!


Kaj Stenberg

unread,
Jan 16, 2018, 1:10:20 AM1/16/18
to
Den måndag 15 januari 2018 kl. 00:18:08 UTC+2 skrev Matti Lehtiniemi:

> Jos ihmisellä on 21000 geeniä ja mehiläisellä 15000 , niin uskon hyvin
> että niiden määrä on luovasti noussut tai laskenut vuosimiljoonien
> kuluessa.(tietysti enemmän noussut)

Joillakin kasveilla ja sammakkoeläimillä on sitten kymmenkertaisesti
tuon määrän...

> Näiden asioiden tutkiminen vaatisi merkittävästi enemmän aikaa ja
> resursseja kuin mihin minä olen valmis.

Onneksesi näihin asioihin _ON_ jo käytetty "enemmän aikaa ja resursseja...". Suuruusluokkaa muutamia nollia lisää..

--
Kaj

Matti Lehtiniemi

unread,
Jan 16, 2018, 2:46:08 AM1/16/18
to
> Onneksesi näihin asioihin _ON_ jo käytetty "enemmän aikaa ja resursseja...". Suuruusluokkaa muutamia nollia lisää..

Tarkoitin itseäni.

Sellainen tuli vielä mieleen mikä saattaisi selittää krea-uskovaisten
raamatun maailmankunvan.

Kun ihminen kasvaa,ihmisen psyykehän ei huomaa kasvamista, vaan maailma
pienenee ympärillä.
Psyykehän näkee vaikka etäisyyden lähimpään kauppaan askelina.Esim 100
askelta.Jos ihminen kasvaa pituutta, etäisyys saattaa muuttua vaikka
90:een askeleen.Samalla ihminen näkee pidemmälle, eli maailma(maapallo)
muuttuu pienemmäksi.

Eli ihminen kokee kehittymisensä maailman muuttumisena.
Kun Egyptissä tapahtui huima kehitys, ja tuli exponentiaalinen
väestönkasvu, se tapa millä ihminen koki maailman ja elämän muuttu aivan
erilaiseksi.Ihmisiä oli paljon enemmän, oli luppoaikaa, ja
mielenkiintoisia asioita pystyi tekemään loputtoman työnteon ja
lepäämisen sijasta.

Eli _maailma_ muuttui kokonaan erilaiseksi.Toisin sanoen voidaan sanoa
että nykymaailma syntyi.
Siksi tämä maailman synnyn ajoittamaminen ramatussa luokkaa 7000 eKr on
eräästä näkökannasta katsottuna ihan tieteellinen versio.
Eihän ole olemassa maailmaa ilman maailmaa havainnoivaa psyykettä.

Matti


Kaj Stenberg

unread,
Jan 16, 2018, 3:02:11 AM1/16/18
to
Den tisdag 16 januari 2018 kl. 09:46:08 UTC+2 skrev Matti Lehtiniemi:
> > Onneksesi näihin asioihin _ON_ jo käytetty "enemmän aikaa ja
> > resursseja...". Suuruusluokkaa muutamia nollia lisää..
>
> Tarkoitin itseäni.
>
> Sellainen tuli vielä mieleen mikä saattaisi selittää krea-uskovaisten
> raamatun maailmankunvan.

Genesisiksen kirjaimellisesti uskovien joukko taitaa kyllä olla olla
aika pieni osapopulaatio uskovaisista.

> Eli _maailma_ muuttui kokonaan erilaiseksi.Toisin sanoen voidaan sanoa
> että nykymaailma syntyi.
> Siksi tämä maailman synnyn ajoittamaminen ramatussa luokkaa 7000 eKr on
> eräästä näkökannasta katsottuna ihan tieteellinen versio.
> Eihän ole olemassa maailmaa ilman maailmaa havainnoivaa psyykettä.

Taidan nähdä mitä ajat takaa. Tutustu kummiskin esim:
https://en.wikipedia.org/wiki/Chauvet_Cave

--
Kaj

Kaj Stenberg

unread,
Jan 16, 2018, 4:12:29 AM1/16/18
to
Den måndag 15 januari 2018 kl. 14:20:27 UTC+2 skrev John Smith:
> Tuomas Yrjövuori wrote:

> > Ja se ympäristö koostuu myös muista olioista, eliöistä, monimutkaisista
> > symbiooseisesta ja kulttuurievoluution luomista järjestelmistä.
> >

Totta.

> Ånkå ihan pakkå paskantaa venttiiliinkin, håmå?

> uʍop ǝpᴉs sᴉɥʇ

Minulle jää vieläkin epäselväksi miksi jotkut aina haluavat korostaa kuinka lapsellisen hölmöjä ovat.

--
Kaj

Martti Mäkelä

unread,
Jan 16, 2018, 11:38:28 AM1/16/18
to
Evoluutiota voisi ajatella kuin kirjoja. Määrättyjä ympäristön asettamia
sääntöjä on. Kuten kirjaa kirjoitettaessa kieli. Mutta kirjoja voi olla
vaikka kuinka monenlaisia.

Se biosfääri mikä me nähdään on vain yksi lukemattomista mahdollisista
joka voisi olla tällaisella pallolla, tällä etäisyydellä sellaisesta
tähdestä kuin aurinko on.


--
Pikaliima on pysyvää

Raimo Suonio

unread,
Jan 30, 2018, 10:38:39 PM1/30/18
to
Itse Matti Lehtiniemi virkkoi, noin nimesi:

> Jaa, ovatko uskovaiset keksineet tƤmƤn termin todistamaan
> itsellensƤ, ettei ihminen ole kehittynyt apinasta ?
>...
> Ihmisen evoluutio on siis kombinaatio: rekombinaatio + mutaatio.
> Mutaatiota tarvitaan siinƤ hypyssƤ kun uusi elƤinlaji syntyy.

Eivät kreationistit ole keksineet termiä "rekombinaatio". He vain
ovat keksineet sille omaan agendaan sopivan tulkinnan. He väittävät,
että rekombinaatio vain yhdistelee toisella tavalla olemassa olevaa
informaatiota, eikä siis voi synnyttää uutta informaatiota. Ja
mutaatiot puolestaan ovat ainoita uusia rakenteita, uutta
informaatiota synnyttäviä tapahtumia (Evoluutio - kriittinen analyysi,
5.2: "- - näiden tekijöiden joukossa mutaatiot ovat ainoa uusien
rakenteiden lähde. Rekombinaatio tosin yhdistelee olemassaolevaa,
mutta ei synnytä uusia geenejä tai alleeleja.").

Esitän alla kaksi vaihtoehtoista tapahtumaa samalla keksityllä,
lyhyellä geenillä. Tapahtuma kuvaa meioosia eli kypsymisjakautumaa,
jossa ituradan solu jakautuu kahdeksi sukusoluksi. Juuri siinä
tapahtuu rekombinaatio ja samalla saattaa tapahtua mutaatioita.

Ituradan solussa on kaksi kopiota kutakin kromosomia ja niissä
vastingeenit, jotka esimerkissä ovat keskenään hieman erilaiset, eli
solussa on kaksi saman geenin eri alleelia, A ja B. Meioosissa
kromosomiparit siirtyvät omiin uusiin sukusoluihinsa, jolloin kussakin
sukusolussa on kustakin geenistä vain yksi alleeli.

Ensimmäisessä esimerkissä tarkasteltu geeni siirtyy sellaisenaan, eli
sukusolu saa alleelin B, mutta mutaatio muuttaa yhdeksänneksi
viimeisen emäksen:

Alleeli A: AAATATTTACTAACTTGGGTACTTATTAGCCTCACGGCGCTTCGTATTTAC
Alleeli B: AAATAGTTACTAACTTGGGTACTTATTAGCCTCACGGCGCTTTGTATTTAC

Sukusolu1: AAATAGTTACTAACTTGGGTACTTATTAGCCTCACGGCGCTTTGTATTTAC

Mutaatio : AAATAGTTACTAACTTGGGTACTTATTAGCCTCACGGCGCTTCGTATTTAC

Tapahtumien jälkeen sukusolussa on periytymisvalmis geeni, joka ei ole
identtinen sen enempää A- kuin B-alleelinkaan kanssa. Periytyvä geeni
on siis uudenlainen, ei kumpikaan alkuperäisistä, eikä vielä ole
tietoa, miten sen koodaama proteiini toimii ja minkälaisia
ominaisuuksia kantajalleen antaa. Voitaisiin tietenkin sanoa, että
samanlainen geeni on ollut ennenkin maapallon biosfäärissä, eikä se
siten olisi uusi eikä uutta informaatiota. Mutta jo 21 emäsparin
pituisella geenillä olisi yli 4 biljoonaa variaatiota ja geenien
keskimnääräinen pituus on noin 29000 emäsparia. Laskimeni ei pysty
edes laskemaan variaatioiden määrää.

Toisessa tapahtumassa rekombinaation crossing-over eli kiasma eli
risteämiskohta osuu keskelle tätä geeniä. Sen sijaan mutaatiota ei
tapahdu. Nyt sukusolun saama geeni koostuu B-alleelin alkuosasta ja
A-alleelin loppuosasta.:

Alleeli A: AAATATTTACTAACTTGGGTACT.TATTAGCCTCACGGCGCTTCGTATTTAC
Alleeli B: AAATAGTTACTAACTTGGGTACT.TATTAGCCTCACGGCGCTTTGTATTTAC

Sukusolu2: AAATAGTTACTAACTTGGGTACT.TATTAGCCTCACGGCGCTTCGTATTTAC

Verrataan tätä sukusolun saamaa geeniä ensimmäisen tapauksen
mutatoituneeseen geeniin:

Mutaatio : AAATAGTTACTAACTTGGGTACTTATTAGCCTCACGGCGCTTCGTATTTAC
Sukusolu2: AAATAGTTACTAACTTGGGTACTTATTAGCCTCACGGCGCTTCGTATTTAC

Huomataan, että ne ovat identtiset. Toinen on mutaation, toinen
rekombinaation tuottama. Nyt kreationistit ovat sitä mieltä, että
noista toinen on mutaation tuottamaa ja mahdollisesti uutta
informaatiota ja toinen rekombinaation tuottamaa ja vain vanhojen
geenien uudelleenjärjestelyä, ei siis uutta informaatiota!

Jos näkisit vain nuo lopputulokset, mistä tietäisit, kummalla tavalla
ne ovat syntyneet? Miksi ei jo voitaisi myöntää, että
rekombinaatiokin on vain eräänlainen mutaation muoto ja ainakin
pistemutaatioita tehokkaampikin uuden informaation tuottaja?


--
Raimo Suonio, Hyvinkää, Finland
http://www.nic.fi/%7Ersuonio/
Oikeinkirjoitusohjeita news- ja web-kirjoittajille:
http://www.nic.fi/%7Ersuonio/oikeinkirjoitus/

John Smith

unread,
Jan 31, 2018, 2:31:48 AM1/31/18
to
Raimo Suonio spämmäsi:

Voisit katsoa, mihin postailet, idiootti.

--
uʍop ǝpᴉs sᴉɥʇ

Raimo Suonio

unread,
Jan 31, 2018, 10:42:08 AM1/31/18
to
Itse Raimo Suonio virkkoi, noin nimesi:

John Smith, pyydän anteeksi ryhmiisi tunkeutumista. Oikea syyllinen on
ketjun aloittaja Timo Tarvonen, jolla on tapana jakaa aloituksensa
laajalti. Me muut emme yleensä vain muista tarkistaa ja karsia niitä
ryhmiä. Yritän parantaa käytöstä omalta osaltani.

John Smith

unread,
Jan 31, 2018, 10:51:59 AM1/31/18
to
Raimo Suonio wrote:
> Itse Raimo Suonio virkkoi, noin nimesi:
>
> John Smith, pyydän anteeksi ryhmiisi tunkeutumista.  Oikea syyllinen on
> ketjun aloittaja Timo Tarvonen, jolla on tapana jakaa aloituksensa
> laajalti.  Me muut emme yleensä vain muista tarkistaa ja karsia niitä
> ryhmiä.  Yritän parantaa käytöstä omalta osaltani.
>
>
----------------->

--
uʍop ǝpᴉs sᴉɥʇ

Turo Juurakko

unread,
Jan 31, 2018, 11:19:29 AM1/31/18
to
Raimo Suonio kirjoitti 31.1.2018 klo 17:42:
> Itse Raimo Suonio virkkoi, noin nimesi:
>
> John Smith, pyydän anteeksi ryhmiisi tunkeutumista.  Oikea syyllinen on
> ketjun aloittaja Timo Tarvonen, jolla on tapana jakaa aloituksensa
> laajalti.  Me muut emme yleensä vain muista tarkistaa ja karsia niitä
> ryhmiä.  Yritän parantaa käytöstä omalta osaltani.

Kannattaa tosiaan tarvosen tapauksessa tsekata aina ensimmäiseksi
viestien levitys eri ryhmiin ja karsia kaikki paitsi yksi pois.
Mieluiten tietenkin kannattaisi jättää kokonaan vastaamatta hänelle,
mutta kun joku aina tarttuu hänen syötteihinsä, eikä tajua karsia ryhmiä
pois, niin sotku on valmis.

Menköön tämä viesti nyt poikkeuksellisesti kahteen ryhmään, jotta kaikki
asianomaiset näkevät sen.

--
mukavan tiukkaa

Raimo Suonio

unread,
Feb 11, 2018, 2:10:11 PM2/11/18
to
Itse Matti Lehtiniemi virkkoi, noin nimesi:

> Minulle opetettiin asia niin ettƤ DNA on kuin vetoketju, toinen
> puolisko tulee isƤltƤ ja toinen ƤidiltƤ.Sitten se vedetƤƤn
> yhteen.

Sinulle on aivan ilmeisesti opetettu väärin, mutta koska

> Suoraan sanottuna en ole erityisen kiinnostunut tƤstƤ asiasta ja
> uskon hyvin ,ettƤ varsinkin sinƤ tiedƤt asian paljon minua
> paremmin. En edes tarkkaan muista mikƤ kromosomi on.

niin tuskin sinä asiasta otat tai edes haluat saada parempaa selkoa,
joten ole onnellinen luuloissasi, joiden varassa sinä voit ylpeänä
esittää varmoja mielipiteitäsi kaikesta tieteestä.

Matti Lehtiniemi

unread,
Feb 11, 2018, 4:56:30 PM2/11/18
to
> niin tuskin sinä asiasta otat tai edes haluat saada parempaa selkoa,
> joten ole onnellinen luuloissasi, joiden varassa sinä voit ylpeänä
> esittää varmoja mielipiteitäsi kaikesta tieteestä.

Hyvin harvoin minä täällä .evoluutiossa mitään kirjoitan.Ihmiset
ristipostaavat tänne joten olen joutunut subscribeamaan tänne.

Olen hyvin kiinnostunut siitä miten ihminen on kehittynyt eläimen
tasolta ihmiseksi evoluutiossa, mutta itse geenitekniikka ei minua
kiinnosta erityisemmin.

Suhteellisuusteoria nyt vaan on roskaa,tai skeidaa niinkuin Petri
Keckmannilla oli tapana sanoa.(jos tähän viittaat "tiedemielipiteelläni")

Yksi hyppy eläimestä ihmiseksi tapahtui 30 000 eKr , jolloin
Pohjois-Amerikan megafauna tuhottiin ja mammutit tapettiin ja
Neardenthalin ihmiset.Siltä ajalta on Homo Sapiensin euroopan valloitus
ja ongenkoukut.Sekä terävät keihäät.Jousi ehkä myös ? Tulentekotaito ?

Varsinainen siirtyminen eläimestä ihmiseksi tapahtuin noin 5000 eKr -
2500 eKr.
Yksi päivä mietin että synnyttiköhän egyptin pyramidit Jumalan ?
Itse olen usein tulkinnut asian niin että Jumala on se tunne meissä joka
kertoo että ihminen pystyy mihin tahansa, sekä pahassa että hyvässä.
Pyramidit olisi ollut sellainen maaginen tunne ihmisen sisällä että
pystymme ihan mihin vaan.
Todellinen hyppy eläimestä ihmiseksi.

Matti

Kaj Stenberg

unread,
Feb 12, 2018, 4:01:12 AM2/12/18
to
Den söndag 11 februari 2018 kl. 23:56:30 UTC+2 skrev Matti Lehtiniemi:

> Yksi hyppy eläimestä ihmiseksi tapahtui 30 000 eKr , jolloin
> Pohjois-Amerikan megafauna tuhottiin ja mammutit tapettiin ja
> Neardenthalin ihmiset.Siltä ajalta on Homo Sapiensin euroopan valloitus
> ja ongenkoukut.Sekä terävät keihäät.Jousi ehkä myös ? Tulentekotaito ?

Jos tuosta sohjosta haluaisi erotella suuremmat virheet niin uskotko
että Pohjois-Amerikka olisi ollut jotenkin merkittävä paikka Homo
Sapiensin synnylle, ja että siellä tapetut mammutit ja
neandertalilaiset olisivat johtaneet näiden lajien sukupuuttoon?


--
Kaj

Kaj Stenberg

unread,
Feb 12, 2018, 4:02:47 AM2/12/18
to
Den söndag 11 februari 2018 kl. 21:10:11 UTC+2 skrev Raimo Suonio:
> Itse Matti Lehtiniemi virkkoi, noin nimesi:
>
> > Minulle opetettiin asia niin ettƤ DNA on kuin vetoketju, toinen
> > puolisko tulee isƤltƤ ja toinen ƤidiltƤ.Sitten se vedetƤƤn
> > yhteen.
>
> Sinulle on aivan ilmeisesti opetettu väärin, mutta koska

Tuskinpa sentään. Se että yksi ihminen voi olla noin väärässä on
jo tarpeeksi uskomatonta. Saatikka sitten että kukaan olisi noin
opettanut.

--
Kaj

Kaj Stenberg

unread,
Feb 12, 2018, 4:08:42 AM2/12/18
to
Den söndag 11 februari 2018 kl. 23:56:30 UTC+2 skrev Matti Lehtiniemi:

> Olen hyvin kiinnostunut siitä miten ihminen on kehittynyt eläimen
> tasolta ihmiseksi evoluutiossa, mutta itse geenitekniikka ei minua
> kiinnosta erityisemmin.

Ihan vain sivuhuomautuksena: geenitekniikka on hyvin eri asia
kuin perusgenetiikka. En toki usko että kummastakaan mitään
ymmärrät taikka että kiinnostaisi oppia, joten spekulaatiosi
tapahtumaketjuista on jo ennakkoon tuomittu menemään täysin
pieleen.

--
Kaj

Matti Lehtiniemi

unread,
Feb 12, 2018, 4:30:55 AM2/12/18
to
> Jos tuosta sohjosta haluaisi erotella suuremmat virheet niin uskotko
> että Pohjois-Amerikka olisi ollut jotenkin merkittävä paikka Homo
> Sapiensin synnylle, ja että siellä tapetut mammutit ja
> neandertalilaiset olisivat johtaneet näiden lajien sukupuuttoon?

Puhuin siitä minkä itse _koemme_ ihmiseksi.Katsoin kerran Akira
Kurosawan elokuvaa ja ihmittelin mitä apinoita siinä oli ja ne oli
ihmisiä(japanilaisia)

Jos törmäisimme ihmiseen 100 000 eKr niin _kokisimmeko_ että kyseinen
ihminen on ihminen vai eläin.

https://fi.wikipedia.org/wiki/Amerikan_historia

"Varhaiset suurriistan metsästäjät perustivat Pohjois-Amerikkaan
mammutteja, hevosia, myskihärkiä, sapelihammaskissoja ja monia muita
sukupuuttoon kuolleita suuria nisäkkäitä metsästäneen Clovisin kulttuurin."

Siis minä olen tulkinnut asian niin ,että Clovisin kulttuuri tappoi nämä
eläimet sukupuuttoon.Eläinten evoluutiossa puhutaan miljoonista
vuosista, ja nämä tapettiin lyhyessä ajassa ,muutamissa tuhansissa
vuosissa.Olematon aika miljoonaan vuoteen verrattuna.Ei sille löydy
muuta selitystä kuin ihminen.

Ne sinun kalliopiirroksesi ovat muuten ajalta 30 000 eKr.Juuri tältä
aikakaudelta mistä puhuin.

Matti


Kaj Stenberg

unread,
Feb 12, 2018, 4:43:20 AM2/12/18
to
Den måndag 12 februari 2018 kl. 11:30:55 UTC+2 skrev Matti Lehtiniemi:

> https://fi.wikipedia.org/wiki/Amerikan_historia
>
> "Varhaiset suurriistan metsästäjät perustivat Pohjois-Amerikkaan
> mammutteja, hevosia, myskihärkiä, sapelihammaskissoja ja monia muita
> sukupuuttoon kuolleita suuria nisäkkäitä metsästäneen Clovisin kulttuurin."

Mutta miksi luet sivustoa joka käsittelee _Amerikan_ historiaa?
_KAIKKIEN_ nykytieteen käsitysten mukaan Amerikka (ehkä Australia)
oli _viimeinen_ manner jonne nykyihminen saapui.

> Ne sinun kalliopiirroksesi ovat muuten ajalta 30 000 eKr.Juuri tältä
> aikakaudelta mistä puhuin.

No, en ole kyllä taitanut sanoa sanaakaan kalliomaalauksista. Mutta
totta, vanhimmat ovat siinä 35,000 vuoden takaa. _Eraasiassa_.

--
Kaj

Matti Lehtiniemi

unread,
Feb 12, 2018, 4:53:56 AM2/12/18
to
> oli _viimeinen_ manner jonne nykyihminen saapui.

Siis minä puhuin siitä minkä _koen_ ihmiseksi, ei se mikä se on
geenitekniikan perusteella.Eli ei siis Homo Sapiens.

Kyllä minä sen Richard Leakeyn tiedän joka näitä asioita on tutkinut
miljoonien vuosien ajalta.Onhan Homo Sapiens vaikka kuinka vanha.

>> Ne sinun kalliopiirroksesi ovat muuten ajalta 30 000 eKr.Juuri tältä
>> aikakaudelta mistä puhuin.
>
> No, en ole kyllä taitanut sanoa sanaakaan kalliomaalauksista. Mutta
> totta, vanhimmat ovat siinä 35,000 vuoden takaa. _Eraasiassa_.
>

Tuon linkin annoit minulle kuukausi sitten:
https://en.wikipedia.org/wiki/Chauvet_Cave

Matti

Kaj Stenberg

unread,
Feb 12, 2018, 4:55:20 AM2/12/18
to
Den måndag 12 februari 2018 kl. 11:30:55 UTC+2 skrev Matti Lehtiniemi:

> Puhuin siitä minkä itse _koemme_ ihmiseksi.Katsoin kerran Akira
> Kurosawan elokuvaa ja ihmittelin mitä apinoita siinä oli ja ne oli
> ihmisiä(japanilaisia)
>
> Jos törmäisimme ihmiseen 100 000 eKr niin _kokisimmeko_ että kyseinen
> ihminen on ihminen vai eläin.

Jos sinulla on vaikeuksia nähdä eron 1900-luvun japanilaisten ja
apinoiden välillä sinulla voisi eittämättä olla vaikeuksia. Mutta
normi-ihmiselle olisi luultavasti yhtä kummallista/tuttua kun jos
törmäisi 1200-luvun "suomalaiseen".

--
Kaj

Kaj Stenberg

unread,
Feb 12, 2018, 5:07:11 AM2/12/18
to
Den måndag 12 februari 2018 kl. 11:53:56 UTC+2 skrev Matti Lehtiniemi:

> Kyllä minä sen Richard Leakeyn tiedän joka näitä asioita on tutkinut
> miljoonien vuosien ajalta.Onhan Homo Sapiens vaikka kuinka vanha.

"Vaikka kuinka vanha" on kyllä hyvin epätarkasti ilmaistu. Jonkinasteinen konsensus tutkijapiireissä on että suku homo erkani ihmisapinoiden
linjasta n. 2 miljoonaa vuotta sitten. Mutta _Homo Sapiens_ ei kyllä
ole kuin n. 250 000 vuotta vanha.

> > No, en ole kyllä taitanut sanoa sanaakaan kalliomaalauksista. Mutta
> > totta, vanhimmat ovat siinä 35,000 vuoden takaa. _Eraasiassa_.

> Tuon linkin annoit minulle kuukausi sitten:
> https://en.wikipedia.org/wiki/Chauvet_Cave

Kas, en muistanut että olin antanut. Mutta silloihan mysteeri
vain tihenee: miksi puhut pohjois-amerikan clovis-kulttuurista
15 000 vuotta sitten jos olet tietoinen tästä "ranskalaisesta"
30 000 vuotta sitten (aikaan jolloinka useimman käsityksen
mukaan pohjoisamerikasta ei löytynyt _minkäänlaisia_ ihmisiä)?

--
Kaj

Matti Lehtiniemi

unread,
Feb 12, 2018, 5:12:36 AM2/12/18
to
> vain tihenee: miksi puhut pohjois-amerikan clovis-kulttuurista
> 15 000 vuotta sitten jos olet tietoinen tästä "ranskalaisesta"

Muistin väärin.Mielestäni jossain kirjassa sanottiin että megafauna
tapettiin 30 000 eKr pohjois-amerikasta.

Okei ,siis 15 000 .Wikipedia väittää ettei mukamas ihminen tappanut
em.lajeja sukupuuttoon.Roskaa, ne on jotain uskovaisia suvakkeja jotka
yrittää vääristäää historiaa ja tehdä ihmisestä paremman kuin mitä se on.

Matti

Kaj Stenberg

unread,
Feb 12, 2018, 5:32:20 AM2/12/18
to
Den måndag 12 februari 2018 kl. 12:12:36 UTC+2 skrev Matti Lehtiniemi:

> Okei ,siis 15 000 .Wikipedia väittää ettei mukamas ihminen tappanut
> em.lajeja sukupuuttoon.Roskaa, ne on jotain uskovaisia suvakkeja jotka
> yrittää vääristäää historiaa ja tehdä ihmisestä paremman kuin mitä se on.

Ihmisellä oli varmasti osarooli esim. mammuttien sukupuuttoon kuolemisella (viimeinen tunnettu n. 5000 vuotta sitten, Wrangelin saari). Mutta
pitää myöskin muistaa että ilmasto muuttui radikaalisesti juuri
noihin aikoihin,
https://en.wikipedia.org/wiki/Quaternary_extinction_event

Varmaa on että pelkästään ihmisen syyttäminen on hyvin
yksinkertaistettu näkemys. Ja jostain "suvakeista" puhuminen
pelkästään lapsellista.

--
Kaj

Matti Lehtiniemi

unread,
Feb 12, 2018, 8:43:23 AM2/12/18
to
> Varmaa on että pelkästään ihmisen syyttäminen on hyvin
> yksinkertaistettu näkemys. Ja jostain "suvakeista" puhuminen
> pelkästään lapsellista.

Intiaanit, punanahat. Niillähän oli kaikkia raakoja tapoja,
toteemipaaluun kiinnittäminen ja kidutus.Sekä skalpeeraus.

Jenkithän piti niitä raakalaisina intiaanisotien aikaan, melkeinpä eläiminä.

Jos he ovat muuttuneet raakalaisiksi juuri tuohon aikaan, kun ilmasto
viileni ja ruoka loppui.Sitten popsittiin megafauna naamariin ja
tapettiin eläinlajeja sukupuuttoon.

Matti

Kaj Stenberg

unread,
Feb 12, 2018, 9:55:47 AM2/12/18
to
Den måndag 12 februari 2018 kl. 15:43:23 UTC+2 skrev Matti Lehtiniemi:
> > Varmaa on että pelkästään ihmisen syyttäminen on hyvin
> > yksinkertaistettu näkemys. Ja jostain "suvakeista" puhuminen
> > pelkästään lapsellista.
>
> Intiaanit, punanahat. Niillähän oli kaikkia raakoja tapoja,
> toteemipaaluun kiinnittäminen ja kidutus.Sekä skalpeeraus.

Skalpeeraus ei kyllä suinkaan ole pelkästään intiaanin keksimä:
https://en.wikipedia.org/wiki/Scalping

Ja kyllä valkoiset eurooppalaiset ovat melko hanakasti kiduttaneet
ihmisiä vuosituhansien kuluessa

> Jenkithän piti niitä raakalaisina intiaanisotien aikaan,
> melkeinpä eläiminä.

Valkoinen mies on pitänyt sekä Australilaisia, Afrikkalaisia,
Etelä-amerikkalaisia, Aasialaisia jne hyvin alhaisessa
arvossa. Kuvastaa lähinnä jotain valkoisesta eurooppalaisesta...

> Jos he ovat muuttuneet raakalaisiksi juuri tuohon aikaan, kun ilmasto
> viileni ja ruoka loppui.Sitten popsittiin megafauna naamariin ja
> tapettiin eläinlajeja sukupuuttoon.

Ongelma tuon teorian kanssa on vaan että mammutit yms kuoli sukupuuttoon
kun ilmasto _lämpeni_ ja pohjoisjäätiköt vetäytyivät.
https://en.wikipedia.org/wiki/Pleistocene_megafauna

Kyllä niitä paljon pahempia joukkoskuolemia on ollut kauan ennen
ihmistä (tosin nyt käynnissä oleva on kyllä ihmisten aiheuttama)

Mutta miten ruokaa on riittänyt ihmiskunnan n. 200 000 vuotisen
historian aikana, siitä on useita näkemyksiä:
https://en.wikipedia.org/wiki/Population_bottleneck

--
Kaj

Raimo Suonio

unread,
Feb 12, 2018, 10:24:04 AM2/12/18
to
Itse Matti Lehtiniemi virkkoi, noin nimesi:

> Olen hyvin kiinnostunut siitƤ miten ihminen on kehittynyt
> elƤimen tasolta ihmiseksi evoluutiossa, mutta itse geenitekniikka
> ei minua kiinnosta erityisemmin.

Oletko ehkä myös hyvin kiinnostunut autotekniikasta, mutta sinua ei
pätkääkään kiinnosta mitkään männät ja hammasrattaat ja kitkapinnat
jne?


> Suhteellisuusteoria nyt vaan on roskaa,tai skeidaa niinkuin Petri
> Keckmannilla oli tapana sanoa.(jos tƤhƤn viittaat
> "tiedemielipiteellƤni")

Olisi kiva kuulla edes yksi peruste mielipiteellesi, mielellään vielä
tieteellisenoloinen sellainen.

Lume Laipio

unread,
Feb 12, 2018, 10:30:36 AM2/12/18
to

"Raimo Suonio"
Itse Matti Lehtiniemi :

>> Suhteellisuusteoria nyt vaan on roskaa,tai skeidaa niinkuin Petri
>> Keckmannilla oli tapana sanoa.(jos tƤhƤn viittaat
>> "tiedemielipiteellƤni")
>
> Olisi kiva kuulla edes yksi peruste mielipiteellesi, mielellään vielä
> tieteellisenoloinen sellainen.


Kahdentoista kaljan jälkeen niitä alkaa taas tulla.



Kaj Stenberg

unread,
Feb 12, 2018, 11:15:50 AM2/12/18
to
Den måndag 12 februari 2018 kl. 15:43:23 UTC+2 skrev Matti Lehtiniemi:

> Intiaanit, punanahat. Niillähän oli kaikkia raakoja tapoja,
> toteemipaaluun kiinnittäminen ja kidutus.Sekä skalpeeraus.

Ja Karl May oli kulttuuriantropologian varsinainen guru ja
edelläkävijä.

--
Kaj

Matti Lehtiniemi

unread,
Feb 12, 2018, 12:01:18 PM2/12/18
to
> Olisi kiva kuulla edes yksi peruste mielipiteellesi, mielellään vielä
> tieteellisenoloinen sellainen.

Joskus käytiin .fysiikassa pitkiä ja pitkiä keskusteluja asiasta.Asia on
vähän samanlainen kuin vähimmäisvarantojärjestelmä, liian uskomaton asia
ollakseen totta.

Aikanaanhan Rolf Nevanlinna tutki suhteellisuusteoriaa, ja kun häntä ei
uskottu niin löi tiskiin nämä varsin moninmutkaisen näköiset
matemaattiset kaavat, joilla atomeja tutkitaan.Ja jotka kehitettiin
Göttingenissä 20-luvulla Diracin, Bohrin jne toimesta.Josta porukasta
osa siirtyi Manhattan -projektiin tekemään atomipommia.

Kun ihmiset putosivat näihin kaavoihin niin hän sanoi että älkää
kritisoiko minun tutkimuksiani.
Kari Enqvist ja kumppanit sitten oppivat tämän saman tekniikan.Kun
voidaan laskea ettei ihmiset jaksa tutkia niitä kaavoja niin voidaan
esiintyä pätevinä tiedemiehinä.Ja atomipommimiehinä.

Sen yhden vuoden minkä opiskelin Helsingin Yliopistossa ennen
siirtymistäni TKK:lle, oli kyllä hyvin tiedossa että assarit laskee
siellä matematiikan eikä nämä Enqvistin kaltaiset atomipommimestarit
oikeasti osaa edes perusmatematiikkaa.

Suhteellisuusteoriaa ei ole ikinä todistettu eikä sitä käytetä
mihinkään.Ei GPS:ään ,ei mihinkään.Sagnac-korjaukset jne ole tutkinut jo
moneen kertaan mitä linkki-Kimi, Kim Fahlström aikanaan minulle
innokkaasti syötti.

Tiede-lehden palstalla voi keskustella suhteellisuusteoriasta, mutta se
on ajanhukkaa.Tämä vähimmäisvarantojärjestelmää pyörittävä Helsingin
eliitin roistoporukka haluaa , että käytämme aikamme johonkin heidän
kannalta merkityksettömään puuhasteluun.

Matti


Ari Saastamoinen

unread,
Feb 12, 2018, 1:25:33 PM2/12/18