what format is needed to upload for trimmed data

[ELC]

Hello,

We want to use SeqBuster to analyze some Illumina data from C.
elegans. I installed the local version of the program in order to trim
the 3' adapters from my reads but the stand-alone version didn't seem
to work. It churned away on a single data file for hours and produced
no output. So instead I trimmed the adapters with fastx_clipper.

What format should I use to upload the resulting data to the
SeqBuster server?

ELC

[lorena.pantano]

Hello, thank to be interested in using SeqBuster.
For the adapter recognition, a fasta format file should work if you
click the option inthe program. Also a file, with columns (tab
separeted),where one of them should contain the sequence. Then in the
header option you should write the header of this file in order to
indicate which column is the sequence.
For instance, your file is:

1(\t)ATGATCGCATCAGCATCGACTCA

and so on, the header option should be:

id-seq

But anyway, if you want to upload directly the sequences you need a
file similar to this:

CATTGCACTTGTCTCGGTCTTC 100 0 0 0 0 100 0 0 0 0 0 100 0 0 100 0 100 0 0
0 0 0 100 0 0 0 0 0 100 100 0 0 0 100 0 0 0 100 0 0 100

This is one row. There are 3 columns. The two first are mandatory, the
third is only related to the adapter consistency and it is calculated
by the stand alone version. So, if you generate one file, of 3 columns
separated by tab, where the first column is the sequence the second
is the counts (number of time the sequence is in the sample) of this
sequences, and the third, whatever, should work.

let me know if you continue having problems.

anyway, there is a complete tutorial (tutorial1) in the web:
http://estivill_lab.crg.es/seqbuster2/, in the section of
documentation, and then tutorial.

Thanks again