Re: Seqbuster ADREC

13 views
Skip to first unread message

Lo

unread,
Aug 8, 2014, 8:08:26 AM8/8/14
to Bludau, Isabell, seqb...@googlegroups.com
Hi,

thanks to contact me.

sorry, about that is a type, because recently I change the order of the
arguments, please just look at the out file, and if it seems ok, there
is no problem.

I will fix this, thanks a lot for the report.

Next time you can open an issue in github:
https://github.com/lpantano/seqbuster

thanks!

On 8/8/14, 4:56, Bludau, Isabell wrote:
> Dear Mrs Pantano,
>
> I'm currently trying to use Seqbuster for my miRNA analysis. In the first step I'm using adrec for adapter trimming with the following command:
>
> java -jar /seqbuster/modules/adrec/adrec.jar -i temp.fq -a TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC -m 1 -l 8 -c 0.3 -s 15 -e 40 -o out
>
> The problem is that I get following information:
>
> Format is not normal fasta
> Go to adapter recognition...
> Mismatches: 1
> Length to be recognized: 8
> Complexity threshold: 0.3
> Adapter: temp.fq
> Minimum size seqs: 15
> Maximum size seqs: 40
> lines: 47000000 -> sequences 45745383...Writing file to upload to the SeqBuster Server...
>
> Writing sequences: 1045419
>
> Number of sequences added: 169192
>
>
> temp.fq is my input file - why does it come up as Adapter in the output information? Is there maybe a mistake in the output information or is the command I use somehow wrong?
>
> I hope to hear back from you soon.
>
> Kind regards,
> Isabell Bludau
>
>
Reply all
Reply to author
Forward
0 new messages