There is an (also interesting) review of it by Ian Stewart in the
January issue of the American Mathematical Monthly.
--
Gerald A. Edgar Internet: ed...@math.ohio-state.edu
Department of Mathematics Bitnet: EDGAR@OHSTPY
The Ohio State University telephone: 614-292-0395 (Office)
Columbus, OH 43210 -292-4975 (Math. Dept.) -292-1479 (Dept. Fax)
> Mathematical Cranks
> This is the title of an interesting book by Underwood Dudley, 1992.
>
> There is an (also interesting) review of it by Ian Stewart in the
> January issue of the American Mathematical Monthly.
Gerald, although you do not mention my name in this poster leader,
the timing and your past bias towards me, I take it as a personal
insult.
Since you are so inclined to infrequently post your opinion of me,
albeit in an undercover manner, I will come right-out into the open and
post my opinion of you. Gerald, you remind me so much of the
untalented egotistical person in the AMADEUS (Mozart) movie. It is such
a shame that some professors of math will learn and absorb so much of
mathematics. Perhaps even teach math well. But never be in the History
of Mathematics. And when they see someone who will be--their first line
of attack is to call them cranks. Such is human nature.
I really shouldn't say anything, oh to hell with it.
Fuck off Ludwig.
>In article <2ghokt$1...@math.mps.ohio-state.edu>
>ed...@math.ohio-state.edu (Gerald Edgar) writes:
>> Mathematical Cranks
>> This is the title of an interesting book by Underwood Dudley, 1992.
>>
>> There is an (also interesting) review of it by Ian Stewart in the
>> January issue of the American Mathematical Monthly.
> Gerald, although you do not mention my name in this poster leader,
>the timing and your past bias towards me, I take it as a personal
>insult.
Ludwig, Gerald not only does not mention your name in the leader, but he
doesn't mention it in the article either. Perhaps before jumping the gun
and *assuming* that this was about you (an assumption based, IMHO, on some
pretty flimsy evidence :-)), it would be better if you actually checked to see
whether this book actually exists. If I were to post a false book
reccommendation (for any reason), I would tack a false, punny author's name
on it. Ludwig, perhaps one of the reasons everyone gets so flamed at you
is that you insult and belittle others with very little provocation or
justification. I understand that you are frustrated with everyone thinking
your ideas are wrong (and worse), but I believe that the responses did not
attack you as a person until you began to get personal. Ludwig, if you
insult people before they attack you, you can be sure that they will retaliate.
I have been enjoying the different threads you have been involved in (for
my own reasons, which are private, and do not necessarily represent the
opinions of my self), but I do find it somewhat unfair (and therefore
upleasant for me to read) when you launch personal attacks against those few
who still do read your posts. I have seen very few other flame wars between
others who disagree with one another in other threads on this newsgroup.
The best way to show your maturity and aptitude for seriousness is to remain
polite and cordial *even when others don't deserve it*. This is the way one
behaves in the professional world, and though you still may not be taken
seriously, it does keep you from descending to the level of those who must
be rude.
>post my opinion of you. Gerald, you remind me so much of the
Please note that I am attempting to follow the above example myself,
instead of posting my personal feelings and opinions.
>post my opinion of you. Gerald, you remind me so much of the
>untalented egotistical person in the AMADEUS (Mozart) movie. It is such
>a shame that some professors of math will learn and absorb so much of
>mathematics. Perhaps even teach math well. But never be in the History
>of Mathematics. And when they see someone who will be--their first line
>of attack is to call them cranks. Such is human nature.
Ah, but Ludwig, this is not so. The movie *Amadeus* was in many ways not
historically accurate. Firstly, Salieri was actually quite celebrated in
his time, and his contributions to music were not left out of the "History
of Music". Secondly, it is said that Salieri and Mozart got on quite well
together. Hovever, this fact would have made for a boring movie. Salieri,
thought not as well known as Mozart, is remembered by the musical community,
a fact which is possible to find, if only you care to look. :-)
Relax, Ludwig. If, as you say, you are to be in the history books, I don't
think you'd care to be remembered as a hothead.
-- Drea
+-----------------------------------------------------------+
| But if we laugh with derision, we will never understand |
| -- S. J. Gould, "Wide Hats and Narrow Minds" |
+-----------------------------------------------------------+
>Ludwig.P...@dartmouth.edu (Ludwig Plutonium) writes:
>>In article <2ghokt$1...@math.mps.ohio-state.edu>
>>ed...@math.ohio-state.edu (Gerald Edgar) writes:
>>> Mathematical Cranks
>>> This is the title of an interesting book by Underwood Dudley, 1992.
>>>
>>> There is an (also interesting) review of it by Ian Stewart in the
>>> January issue of the American Mathematical Monthly.
>> Gerald, although you do not mention my name in this poster leader,
>>the timing and your past bias towards me, I take it as a personal
>>insult.
>Ludwig, Gerald not only does not mention your name in the leader, but he
>doesn't mention it in the article either. Perhaps before jumping the gun
>and *assuming* that this was about you (an assumption based, IMHO, on some
>pretty flimsy evidence :-)), it would be better if you actually checked to see
>whether this book actually exists. If I were to post a false book
>reccommendation (for any reason), I would tack a false, punny author's name
>on it. {remainder deleted]
I may be struck dead for replying to an LP thread, but I must come to the
defense of Underwood Dudley. Both he and his book _Mathematical Cranks_
(published by MAA) are entirely real. He's a math professor at DePauw who
has a longstanding interest in angle trisectors, circle-squarers, and other
pursuers of the mathematically impossible. The boo, BTW, is fun.
--
----------------------------------------------------------------------
Steve Wildstrom Business Week Washington Bureau wi...@access.digex.net
"These opinions aren't necessarily mine or anyone else's."
-----------------------------------------------------------------------
> Relax, Ludwig. If, as you say, you are to be in the history books, I don't
> think you'd care to be remembered as a hothead.
>
>
> -- Drea
Thanks Adrienne. Your points are well taken. I do not want to be
labelled as a hothead. I have seen several of Gerald's prejudices and
this one stirred me. Ohio State publishes a Number theory journal which
rejected/ignored my request to publish and so as I am trying to *build*
my ideas on the network and see someone from Ohio State labelling me,
telling others to kill-file-me, I think it was a matter of time before
I spoke-up. But you are correct, I should be polite. I wonder if Galois
would have gotten further if he had been polite, I kind of doubt it?
Sounds like a hothead to me.
Bruno. br...@andrew.cmu.edu
>In article <2ghokt$1...@math.mps.ohio-state.edu>
>ed...@math.ohio-state.edu (Gerald Edgar) writes:
>
>> Mathematical Cranks
>> This is the title of an interesting book by Underwood Dudley, 1992.
>>
>> There is an (also interesting) review of it by Ian Stewart in the
>> January issue of the American Mathematical Monthly.
>
> Gerald, although you do not mention my name in this poster leader,
>the timing and your past bias towards me, I take it as a personal
>insult.
The timing is easy to explain -- the most recent Monthly, which contains
the review, arrived in the mail in the past week. That's all there is to
it.
I am afraid that what you have done, Ludwig, is to commit the logical
fallacy called "argument from silence" -- that is to say, you drew a
conclusion from the ABSENCE of information, which is a logical no no. Now,
a CRANK would VEHEMENTLY DENY that he made any reasoning errors. Since you
are NOT a crank, we are confident that you will LEARN from your mistakes
and not repeat them again in this forum, because THAT is what true scholars
do.
> Since you are so inclined to infrequently post your opinion of me,
Does this mean that you would like him better if he posted his opinion of
you more often? That does seem to be supported by a literal reading of
your statement.
Fred Chapman
--
o ------------------------------------------------------------------------- o
| Frederick W. Chapman, User Services Office Phone: (215) 758-3218 |
| Computing Center, Lehigh University Internet E-mail: fc...@Lehigh.Edu |
o ------------------------------------------------------------------------- o
> Thanks Adrienne. Your points are well taken. I do not want to be
> labelled as a hothead. I have seen several of Gerald's prejudices and
> this one stirred me.
Come, now. He didn't even mention your name. You proclaimed yourself
as a crank when you blew up at that post which had no direct evidence
of having anything to do with you.
> . . . so as I am trying to *build*
> my ideas on the network and see someone from Ohio State labelling me,
> telling others to kill-file-me, I think it was a matter of time before
> I spoke-up.
Kill-filing is a purely voluntary affair.
Now was it you or Hannu that was under the impression that there was a
kill policy against you, because no one was replying? In fact,
individual people do it because you're ANNOYING.
But, nevertheless, entertaining, in a strange sort of way. It's like
being near a car accident. You don't want to look, but you find a
strange compulsion forcing you to.
Erik Max Francis, &tSftDotIotE ...!uuwest!alcyone!max m...@alcyone.darkside.com
USMail: 1070 Oakmont Dr. #1 San Jose, CA 95117 ICBM: 37 20 N 121 53 W __
AGCTACTGTACGTACGTTTGCACGTATGCTGTGCACTGCATXCTGACATCGTGACTGATCTGCATGACTTGCA / \
"Omnia quia sunt, lumina sunt." (All things that are, are lights.) \__/
- aesop
------------------------------------------------------------------------
"Truth, left to itself, will persevere against all odds." -T.Jefferson
------------------------------------------------------------------------
> Hey -- I'm not afraid of saying it
Some idiot hiding behind the name of Aesop. Whoever you are, you
should be ashamed that you use the great name of Aesop. I bet you do
not even know Aesop's life history. For if you did, you would be
ashamed of using his name for your smear campaigns; his great name for
your trite and juvenile posts.
I also think Plutonium is a crank! I read and enjoy the posts, I also
pride myself on having a very open mind on most any subject. I don't
feel Plutonium is a crank because of his mathematics, in fact, I haven't
seen enough of his theories to form an opinion. But the egotistical,
almost maniac manner he responds to the slightest hint of criticism
obscures any relevant contributions he may have to make to mathematics.
A true original thinker isn't worried what people think of him. Just
continue working on what you feel is important, and publish your results
wherever you can. The Internet is an ideal medium. NO CENSORSHIP!
People are reading what you write. If a valid criticism arises, respond,
and ignore the flames. If what you write has value, you will be
recognized for it. If its trash, you'll be ignored. Just don't assume
I'm an idiot if I don't agree with you. In my book Plutonium is a CRANK!
Love, Richard A. Witt.
--
Remember son, it's better to kill than to maim.
Dead people can't sue.
> I also think Plutonium is a crank! I read and enjoy the posts, I also
> pride myself on having a very open mind on most any subject. I don't
> feel Plutonium is a crank because of his mathematics, in fact, I haven't
> seen enough of his theories to form an opinion. But the egotistical,
> almost maniac manner he responds to the slightest hint of criticism
> obscures any relevant contributions he may have to make to mathematics.
> A true original thinker isn't worried what people think of him. Just
> continue working on what you feel is important, and publish your results
> wherever you can. The Internet is an ideal medium. NO CENSORSHIP!
> People are reading what you write. If a valid criticism arises, respond,
> and ignore the flames. If what you write has value, you will be
> recognized for it. If its trash, you'll be ignored. Just don't assume
> I'm an idiot if I don't agree with you. In my book Plutonium is a CRANK!
>
> Love, Richard A. Witt.
>
> --
> Remember son, it's better to kill than to maim.
> Dead people can't sue.
Many people will give me good advice on how to run a science and math
revolution.
One thing many advice givers overlook is that a revolution is
different from the "normal science or math work." I feel those giving
me good advice are neglecting that aspect.
Most people would agree that a science and math revolution comes
infrequently, but normal science and math goes on around the clock.
They do not understand the magnitude of difference between the two.
Most people never have a revolutionary idea which would change the
World. Are those people qualified to give Gauss advice on NonEuclidean
Geom., or Galois advice on Group theory, or Bohr on Quantum Mechanics?
Thanks to all the people who want to give me advice and please be not
annoyed if I do not heed them. I read them. There is one psychological
aspect about running a revolution which I like to acquant you with. It
is a tremendous relief and release on me when I do state my question in
my own aggressive manner. It is a cathartic relief, and if it does no
visible good it does alot of good for me.
I see that my revolutionary idea is being repressed because I am
replacing God with an atom. Even if I solved every outstanding math
problem extant, and created brand new, beautiful mathematics, and give
the correct theory of superconductivity, and much, much more. The
presses around the world will not publish me. They will avoid me at all
cost. They see me as worse than the Black Plague. They instinctively
know that the HOWL OF THE BOEOTIANS will be at their doors the moment
they publish Plutonium Atom Totality. God an Atom? Will come the myriad
shrieks and screams from all directions.
I could be polite and say --please Mr. Hawking and Mr. Penrose how
does a star gravitate past the Pauli Exclusion Principle into a black
hole, your only answers is that it just does. Please Mr. Hawking and
Mr. Penrose that makes no sense to me for a principle is a principle
and if you violate it just to suit yourselves to create an entity
called a black hole, then what do I do with the Pauli Exclusion
Principle?
Or I could state my question just the way I feel, and release the
cartharsis, which takes into account that these two gentlemen will
ignore me, but it grabs their attention and other peoples attention and
it shakes their own confidence. The way I ask the question leaves no
margin of doubt as to what side I am on. Here is the way I would ask
Messr. Hawking and Penrose.
TO: Messr. Hawking and Penrose
I hope someone does two books in the future to be titled THE RISE AND
FALL OF BRITISH PHYSICS and GOOFBALL PHYSICS.
When Paul Dirac departed UK and left the seat to Hawking marks the
rapid decline of physics in Britian.
On the one hand we have the Pauli Exclusion Principle, never in
violation. PEP gives chemistry and biology. If it were not for PEP we
would not be here to discuss anything. Yet a goofball birdbrain of a
physics major named Hawking thinks that just because you have alot of
mass that PEP will be violated. He never understood that gravitational
collapse does just the opposite of crushing but rather it does heavier
element nucleosynthesis. This nitwit named Hawking then publishes a
book which becomes a best seller, not because the science is truthful,
but because many other nitwits of science trumpet this goofball. Even
the journal MANURE (Nature) gives him free publicity. Hawking violates
PEP, but since he is crippled the world at large never asks him science
questions, they only admire him, and awe him. Penrose sees how
lucrative birdbrain science can be and so he jumps into the act to rake
up millions for himself. The Nobel prize committee though is not fooled
by this science fakery. And the latest idiocy of British decadence is
the uncalled for attack against cold fusion by Frank Close. He was
named appropriately for physics is closed in the UK. These two books
should clearly state that Paul Dirac saw what a birdbrain Hawking was,
and departed Britian for a better climate because he saw what was
coming. Ever since P.A.M. Dirac departed Britian, it was downhill for
physics there.
Indeed. Trite and juvenile posts should instead be hidden behind the name
of a chemical element.
Gerhard Molybdenum
You haven't been paying attention to CNN down there in .ZA -- our
benevolent Government here in the USA recently solved all our problems
by giving everyone a new name based on the name of some chemical element,
color, or vegetable plus a number. We now all have 'artificial extended
families' and love and trust one another and everything is perfect.
The entire process is documented in an excellent non-fiction
book on sociobiology, "Slapstick" by Kurt Vonnegut. You may remember
Kurt Vonnegut as the author of "Chariots Of The Gods?" in the seventies.
-- James "Kibo" Parry Cesium 7
> To be a crank one has to be serious. How serious is a guy who calls himself
> Ludwig Plutonium. Okay maybe his first name is Ludwig (shame :-) ) but
> Plutonium????
>
Ummm...I am *from* the same place that Ludwig is. When he says that his
name is Ludwig Plutonium, he is right. He legally changed it to that in
honour of his "discoveries". This is rather easy to check since all
that you need to do is write to anyone in the math department here (it
is not that hard to get a list of people at dartmouth through the AMS
directory) and ask them about it and they will confirm what I am saying
about him.
He *is* serious about his theories. It is not a joke on his part.
Ben Tilly
I really find it hard to believe that a person could get his name
LEGALLY changed to "Plutonium". Ludwig may _claim_ to have had his name
changed, but that alone is not proof of a legal name-change. Could you
perhaps point me to a court document or other evidence that "Ludwig Plutonium"
is the fellow's true, legal name?
By the way, how is Plutonium connected to Dartmouth? If he's a
student,what department is he in?
Sincerely,
Richard Douglas Chatham
I've been informed that Ludwig has had his name legally changed to Ludwig
Plutonium. Now I agree that he is a crank.
Colin Nitrogen
>
> > To be a crank one has to be serious. How serious is a guy who calls himself
> > Ludwig Plutonium. Okay maybe his first name is Ludwig (shame :-) ) but
> > Plutonium????
> >
> Ummm...I am *from* the same place that Ludwig is. When he says that his
> name is Ludwig Plutonium, he is right. He legally changed it to that in
> honour of his "discoveries". This is rather easy to check since all
> that you need to do is write to anyone in the math department here (it
> is not that hard to get a list of people at dartmouth through the AMS
> directory) and ask them about it and they will confirm what I am saying
> about him.
>
> He *is* serious about his theories. It is not a joke on his part.
Considering the e-mail that I have recieved I should add that he is not
part of the math department here in any way. He gets an account since
he is classified as an employee of the college. (He works for an inn
that is owned by Dartmouth.) However he makes himself rather
conspicuous on campus so people in the math department are rather aware
of him. (For basically the same reason that people on sci.math are
aware of him.)
Ben Till´
> I really find it hard to believe that a person could get his name
> LEGALLY changed to "Plutonium". Ludwig may _claim_ to have had his name
> changed, but that alone is not proof of a legal name-change. Could you
> perhaps point me to a court document or other evidence that "Ludwig Plutonium"
> is the fellow's true, legal name?
I do not have a court document handy, but apparently he did change his
name a while ago. This is common knowledge around here although it
happened before I came here. From what I understand he has actually
changed his name several times, and this is merely his latest one. And
from what I understand you can get your name changed to practically
anything as long as you are willing to pay money and go through the
system. The only other evidence that I can give you is that his entry
in the Dartmouth Name Directory gives Ludwig Plutonium as his name and
Ludvig as his nickname. To the best of my knowledge they list the legal
name there regardless of what people want them to list.
> By the way, how is Plutonium connected to Dartmouth? If he's a
> student,what department is he in?
He is a dishwasher at the Hanover Inn. Since the Inn is owned by the
College he can get an account as an employee. He then can use any of a
number of public clusters of macs and post essentially whatever he
wants. Given the policy here it is impossible to stop him, or anyone
else with a similar connection, from posting as long as he does not
break any laws, or violate computer security in any serious way. Which
he has not done and shows no interest in doing that I have ever heard
of.
Ben Tilly
I'm going to assume that James Kibo Parry Cesium 7 actually means James
Kibo Parry -is- Cesium 137.
Thus, by looking up Cs-137 in my handy-dandy Chart of The Nuclides, 14th
Edition, and crossreferencing the data contained therein with basic
equations from _Introduction to Nuclear Engineering_ by John LaMarsh, and
assuming that Kibo is comprised of approximately 150 pounds of Cs137, which
would convert to about 6700g.... lessee, n(t)=no*e^-lambda*t.....
lambda=ln2/halflife, so that would give us the following:
Amount of annoyance Kibo will cause the net at any time (t) from now is
equal to the amount he currently annoys you multiplied by the quantity
e^(-0.02t) ........ but, this is just a theory on my part.... based on
careful research, looking back thru my old NUCL200 notebook, and a bad
pizza.
Bill Blum.
Kibo should be half the thorn in USENET's side he currently is in say, oh,
30.17 years....barring several dozen nuclear reactions that involve Kibo
changing his name to Plutonium. :)
--
Bill Blum N9VLS bl...@sage.cc.purdue.edu Purdue University, W. Lafayette, IN
"Now we are going to the cultural sensitivity seminar, and we will learn to
be nice, and sensitive, or so help me I'll kill you both." -Miles
Silverberg, from _Murphy Brown_.
Well, 5 seconds with our old pal Gopher sez:
-200:1: name: Ludwig Plutonium
-200:1: nickname: Ludvig
-200:1: deptclass: INN
-200:1: hinmanaddr: HB 6165
-200:1: email: Ludwig.P...@Dartmouth.EDU
-200:1: phone:
whatever INN is...
i just love this trivial bickering...
-- flip
Sorry that the following comment is not at all connected to the current
thread, but I can't see the name of Kurt Vonnegut dragged down to such a
level. "Chariots of the Gods" was written by Eric von Daniken, not
Vonnegut.
Matt.
-------------------------------------
Matthew C. Clarke <cla...@unpsun1.cc.unp.ac.za>
(PGP Public Key available on request or by Fingering P...@mac.cs.unp.ac.za)
- aesop
> He is a dishwasher at the Hanover Inn. Since the Inn is owned by the
> College he can get an account as an employee. He then can use any of a
> number of public clusters of macs and post essentially whatever he
> wants.
He's a dishwasher. A dishwasher.
And he uses a Mac.
I'm actually thinking of using a much better name,
Wolfgang Elipton.
In article <CJt78...@mentor.cc.purdue.edu>
bl...@sage.cc.purdue.edu (Bill Blum) writes:
> Kibo should be half the thorn in USENET's side he currently is in say, oh,
> 30.17 years....barring several dozen nuclear reactions that involve Kibo
> changing his name to Plutonium.
Consciously spurred aesop to post the following.
In article <L50cgc...@fred.com>
ae...@fred.com (aesop) writes:
> Some of the most serious cranks are -very- serious !
>
> - aesop
But subconsciously aesop wanted to say this.
"Some of the most serious shanks are -very- desirous!
Because aesop is a gay person; pent-up and repressed in an ivory tower.
Notice the infatuation with the word "serious", subconsciously close to
the word "sir." Watch aesop's future postings for more clues to his
gayness.
: "Some of the most serious shanks are -very- desirous!
: Because aesop is a gay person; pent-up and repressed in an ivory tower.
: Notice the infatuation with the word "serious", subconsciously close to
: the word "sir." Watch aesop's future postings for more clues to his
: gayness.
I think perhaps you are reading a bit much into his posting, Ludwig. But
what's wrong with being gay?
> > Some of the most serious cranks are -very- serious !
>
> But subconsciously aesop wanted to say this.
>
> "Some of the most serious shanks are -very- desirous!
>
> Because aesop is a gay person; pent-up and repressed in an ivory tower.
> Notice the infatuation with the word "serious", subconsciously close to
> the word "sir." Watch aesop's future postings for more clues to his
> gayness.
I take it that, in addition to being a complete moron, you're also a
bigot?
No, no, no, you're thinking of Eric von Stroeheim. von Daniken invented
the V-2 missile, and his brother founded General Electric.
-- K.
Didn't they call him "Willy Ley" in honor of his speculative nocturnal
beer hall excursions?
: > > Some of the most serious cranks are -very- serious !
: >
: > But subconsciously aesop wanted to say this.
: >
: > "Some of the most serious shanks are -very- desirous!
: >
: > Because aesop is a gay person; pent-up and repressed in an ivory tower.
: > Notice the infatuation with the word "serious", subconsciously close to
: > the word "sir." Watch aesop's future postings for more clues to his
: > gayness.
: I take it that, in addition to being a complete moron, you're also a
: bigot?
Upon what do you base that inference, Mr. Francis? Upon the fact that
Mr. Plutonium used the word "gay" without placing a big \/ in his
.signature? Or upon the fact that he, probably a flaming breeder,
dares to mention sexual preferences?
Mr. Plutonium has not said that he thinks that there is anything wrong
with being gay; nor has he singled gay pe^H^Hand lesbian persons out.
On the contrary, in the past, he has accused someone of being a tree.
In all fairness, there is nothing to indicate bigotry on Mr. Plutonium's
part, unless bigotry is defined as "mention of sexual preference by a
straight without the requisite guilt-prompted deference".
What this has to do with Kibology, I do not know. But then again, I have
asked the same question about frame-by-frame laserdisc reviews.
--
Andrew Bulhak | When Ludwig takes a plutonium pill the cranks begin to worry
a...@yoyo.cc\ | They can't escape the awful fate of Pluton's mighty fury
.monash.edu.au | Ludwig Plutonium he's our man, hadron of our nation,
| Spontaneous radioactive neutron materialisation...
>Or upon the fact that [Ludwig], probably a flaming breeder,
Shouldn't the Nuclear Regulatory Commission be informed of this?
--
Paul Callahan
call...@biffvm.cs.jhu.edu
>> Some of the most serious cranks are -very- serious !
>
> But subconsciously aesop wanted to say this.
>
> "Some of the most serious shanks are -very- desirous!
>
> Because aesop is a gay person; pent-up and repressed in an ivory tower.
> Notice the infatuation with the word "serious", subconsciously close to
> the word "sir." Watch aesop's future postings for more clues to his
> gayness.
*shakes head in utter disbelief*
This is without a doubt the most astonishingly pitiful and
absurd post I have seen to date from Ludi. And that's something
few posts can aspire to.
By the way, if there is anyone around who needs to watch
carefully for clues it is you, Mr. Plutonium. Just be careful
that they don't muss your hair as they whiz past your head.
Scott
ObMath: \pi
--
>
> *shakes head in utter disbelief*
>
> This is without a doubt the most astonishingly pitiful and
> absurd post I have seen to date from Ludi. And that's something
> few posts can aspire to.
>
> By the way, if there is anyone around who needs to watch
> carefully for clues it is you, Mr. Plutonium. Just be careful
> that they don't muss your hair as they whiz past your head.
>
> Scott
In my opinion, Scott is a psychological misfit. None of his posts
surprize me anymore. Scott's posts are like dog shit stuck between the
cleats of my boots. If Scott teaches students, I pity them for they
would learn more about bad human character than math<(:-)
> On the contrary, in the past, he has accused someone of being a tree.
Pu, Pluto, bless Andrew Bulhak to the Fields of Elysium.
[...]
>In article <L50cgc...@fred.com>
>ae...@fred.com (aesop) writes:
>
>> Some of the most serious cranks are -very- serious !
>>
>> - aesop
>
>But subconsciously aesop wanted to say this.
>
> "Some of the most serious shanks are -very- desirous!
>
>Because aesop is a gay person; pent-up and repressed in an ivory tower.
>Notice the infatuation with the word "serious", subconsciously close to
>the word "sir." Watch aesop's future postings for more clues to his
>gayness.
Even if your claim about "aesop" were true, I fail to see how the quality
of being gay is either (1) pejorative, (2) disparaging, or (3) relevant.
You might as well claim that he posted what he did because he has blue
eyes.
Fred Chapman
--
o ------------------------------------------------------------------------- o
| Frederick W. Chapman, User Services Office Phone: (610) 758-3218 |
| Computing Center, Lehigh University Internet E-mail: fc...@Lehigh.Edu |
o ------------------------------------------------------------------------- o
> Even if your claim about "aesop" were true, I fail to see how the quality
> of being gay is either (1) pejorative, (2) disparaging, or (3) relevant.
> You might as well claim that he posted what he did because he has blue
> eyes.
>
> Fred Chapman
My post there Fred was the quickest ruse I could think of at that
instant of time when I read aesop's post. I had remembered reading
aesop's negativism some months ago. Instead of coming outright and
saying how can I find out who is this character's true identity and
organization. I thought I would try the most compact discrediting
tactic. Simply call him gay. That tactic starts all the eyes looking
into aesop. Personally I have nothing against homosexuals. I could not
dream of a better world then if all men were gay except me, leaving all
the females to me. In fact I have a scientific explanation of
homosexuality which falls-out of PU totality. In the previous past life
a homosexual male was a female then. It is a predominance of female
photons which are entering his life now.
And I like the saying "Being human, nothing human is foreign to me."
Knowing the PU theory that is a nice summary of human etiquette and
ethics, for everyone of our electrons within each one of our bodies
extends out to infinity, overlapping with everyone else's electrons.
That is sympathy and empathy with a vengeance.
No, Fred, I think most Netters out there saw through my ruse. I had
posted the ruse to alt.religion.kibology to get alot of those good
humored pals over there in on the game. Point blank-- I wanted to smoke
out aesop in the shortest and most compact ploy. I think I was
successful, because from now on aesop's future posts, noone will place
much value to them.
Personally I like the network where anonymous posters can exist. The
worst to happen to the Network is censorship.
I submit this as evidence to anyone who still believes that Ludwig
Plutonium, deep down, still has a shred of humanity, or that he does not
need to get a life.
--
Terry Tao Math Dept., Princeton University (t...@math.princeton.edu)
"God is dead." - Nietzsche
"Nietzsche is dead." - God
"Nietzsche is God." - The Grateful Dead
> My post there Fred was the quickest ruse I could think of at that
> instant of time when I read aesop's post. I had remembered reading
> aesop's negativism some months ago. Instead of coming outright and
> saying how can I find out who is this character's true identity and
> organization. I thought I would try the most compact discrediting
> tactic. Simply call him gay.
You need help.
> Personally I like the network where anonymous posters can exist. The
> worst to happen to the Network is censorship.
Gee, and why would that be, Herr Plutonium?
Erik Max Francis, &tSftDotIotE ...!uuwest!alcyone!max m...@alcyone.darkside.com
USMail: 1070 Oakmont Dr. #1 San Jose, CA 95117 ICBM: 37 20 N 121 53 W __
AGCTACTGTACGTACGTTTGCACGTATGCTGTGCAXTGCATACTGACATCGTGACTGATCTGCATGACTTGCA / \
> thought I would try the most compact discrediting
> tactic. Simply call him gay.
Indeed, you discredited yourself quite efficiently thereby.
> > thought I would try the most compact discrediting
> > tactic. Simply call him gay.
>
> Indeed, you discredited yourself quite efficiently thereby.
John does not need any discrediting agent, nor crediting agent. John,
why can you not stay put in alt.religion.kibology where your jokes and
training originated. John Baez is the headmaster, superintendant, and
principal of the University of Alt.Religion.Kibology.
> John does not need any discrediting agent, nor crediting agent. John,
> why can you not stay put in alt.religion.kibology where your jokes and
> training originated. John Baez is the headmaster, superintendant, and
> principal of the University of Alt.Religion.Kibology.
Yes, whereas you are the chief proponent of gay bashing in sci.astro.
Put a cork in it, already.
Now, if this university was run by nuns, would that make him a Mother Superior?
--
Andrew Bulhak a...@yoyo.cc.monash.edu.au
QUESTION REALITY.
> Yes, whereas you are the chief proponent of gay bashing in sci.astro.
> Put a cork in it, already.
I don't know about sci.astro, but we have at least one virulent homophobe
who posts to sci.math--Mikhail Zeleny. We have one passionate defender
of homophobia and probable homophobe who posts here--Tal Kubo. These
guys may strike you as more respectable than Mr. von Plutonium, but
I don't think that is a good reason to pick on him for homophobia under
the circumstances.
--
Gene Ward Smith/Brahms Gang/University of Toledo
gsm...@uoft02.utoledo.edu
Ludwig, you are no longer funny.
You are hereby booted out of my scorefile.
5150
--
I've turned into sil!
- Kibo
>In article <1994Jan30...@uoft02.utoledo.edu>
>gsm...@uoft02.utoledo.edu (Gene Ward Smith) writes:
>>I don't know about sci.astro, but we have at least one virulent homophobe
>>who posts to sci.math--Mikhail Zeleny. We have one passionate defender
>>of homophobia and probable homophobe who posts here--Tal Kubo. These
>>guys may strike you as more respectable than Mr. von Plutonium, but
>>I don't think that is a good reason to pick on him for homophobia under
>>the circumstances.
>Dr. Smith has seriously damaged his public credibility with this posting.
You catch me off guard, for I was unaware of any public credibility
residual in Dr G.
>I have never expressed any opinion on homosexuality in public, let alone
>in Usenet newsgroups.
I think I can vouch for a substantial part of the former, and most of
the latter.
>Gene Smith and Mikhail Zeleny have both published such opinions in other
>newsgroups. As above, Smith claimed that Zeleny is a homophobe and
>all-around gay-hater. Since I knew Zeleny personally and had read his
>postings, I knew that these claims were false and said so on the net.
>Other posters, including some who disagreed strenuously with Zeleny's
>positions, agreed with my contention that the postings in question were
>neither "full of hatred" nor "homophobic". In response I too was labelled
>a "homophobe" by Dr Smith.
I do not know about being virulent, now that the Peking flu has had its
day, but perhaps responding to Dr Smith's blowhard drivel indeed makes
me a reactionary homophobe. Still, as Smith knows perfectly well, my
stated political views ensure that I bear no malice toward him or his
equally unfortunate inverted confederates, however much I find their
sexual practices to be morally reprehensible. Even now, I cannot muster
any anger in response to his unprovoked polluting of sci.math with petty
and vindictive political agenda, exemplified by the risible coinage of a
new PC term of opprobrium, "defender of homophobia". Smith is a sick
man, utterly consumed by his impotent rage against his own indefensible
position. Whatever petty joy I may experience in pulling his strings,
it is always mitigated by a recognition of his compulsive pathology.
Time for you to see a real doctor, Dr G.
>Gene Smith is frustrated that Mr. Zeleny has been able to flog him verbally
>and intellectually in newsgroups read by thousands of educated people.
>Zeleny has out-thought, out-smarted, out-written, out-argued and out-flamed
>him in numerous public exchanges, in most of which Smith was finally
>reduced to petty sniping and vitriolic, incoherent rage. Dr. Smith, who is
>proud of his cleverness and learning and has a large Usenet ego, must be
>very resentful that a person he finds so odious humiliates him in argument
>after public argument.
Call me a Freudian, but I think that Smith finds the odium in himself,
in the measure of his persistence with these exchanges. The rest is a
clear case of negative transference. The humiliation is icing on the
cake.
>Make no mistake about it: what we are seeing now, is an attempt by Dr Smith
>to fight personal conflicts by professional means. This is despicable
>behavior and should be condemned as such. Thousands of mathematicians,
>including many people who are potentially my future employers and
>colleagues, read sci.math. I suppose the same is true of Zeleny's future
>employers (philosophers and logicians). Political arguments over subjects
>like homosexuality are virtually unknown here, the set of non-lurkers
>relatively small, and so accusations of bigotry against a couple of the
>regulars are likely to be remembered for some time. As Dr Smith knows,
>advancement in our field is largely a matter of social as well as
>mathematical acceptability. Hence the attempt to discredit as "homophobes"
>people whom he cannot punish by legitimate means. I have no interest in
>taking legal action but I suppose a case could be made that this is libel.
I doubt it. Mr Webster informs me that, in order to qualify as libel,
Smith's defamatory statement must succeed in conveying an unjustly
unfavorable impression of me, or expose me to public contempt. His
mistake is in shrilly promulgating it before an audience that is too
sophisticated to allot any credibility to an unsubstantiated act of
branding another with a contentious label. I rest confident in my
colleagues' abilities to discern the true merits of our respective
positions in this confrontation.
>Neither Zeleny nor I ever posted anything about homosexuality in this
>thread or in sci.math. Neither of us had our names mentioned anywhere in
>the thread to which Dr Smith replied. The present round of postings started
>by Ludwig Plutonium's "gay" remark is, as far as I can remember, the first
>time that the subjects of homosexuality and homophobia have ever been
>broached on sci.math. (Ignoring some off-color humor in the threads on math
>jokes). Dr Smith, therefore, is going out of his way to fight his personal
>battles through professional means. I repeat: this is a despicable
>practice and should be condemned as such.
>
>As Allan Adler eloquently pointed out here in his postings on "Social
>Harassment" a couple of years ago, mathematicians have a long way to go in
>learning to separate their private and professional affairs. Dr Smith's
>posting illustrates the downside of this situation.
Vindictiveness is not unique to mathematicians. I have no interest in
perpetuating an irrelevant topic on sci.math. Anyone interested in my
position on the issue that gave rise to this discussion, is welcome to
request an AMS-LaTeX draft of my paper on Kant, which covers its moral
aspect. Please note the follow-up.
>Tal Kubo
>ku...@math.harvard.edu
>--------------------------
>"Everything is impressive in large enough proportions -- even stupidity"
> -- Erich Kastner
>.
Cordially, - Mikhail | Why is it that all those who have become eminent
Zel...@math.ucla.edu | in philosophy or politics or poetry or art
UCLA Philosophy Dept | are clearly of an atrabilious temperament?
> I don't know about sci.astro, but we have at least one virulent homophobe
> who posts to sci.math--Mikhail Zeleny. We have one passionate defender
> of homophobia and probable homophobe who posts here--Tal Kubo. These
> guys may strike you as more respectable than Mr. von Plutonium, but
> I don't think that is a good reason to pick on him for homophobia under
> the circumstances.
Just because other people are reactionary homophobes but aren't total
morons doesn't make it all right or acceptable behavior here.
Dr. Smith has seriously damaged his public credibility with this posting.
I have never expressed any opinion on homosexuality in public, let alone
in Usenet newsgroups.
Gene Smith and Mikhail Zeleny have both published such opinions in other
newsgroups. As above, Smith claimed that Zeleny is a homophobe and
all-around gay-hater. Since I knew Zeleny personally and had read his
postings, I knew that these claims were false and said so on the net.
Other posters, including some who disagreed strenuously with Zeleny's
positions, agreed with my contention that the postings in question were
neither "full of hatred" nor "homophobic". In response I too was labelled
a "homophobe" by Dr Smith.
Gene Smith is frustrated that Mr. Zeleny has been able to flog him verbally
and intellectually in newsgroups read by thousands of educated people.
Zeleny has out-thought, out-smarted, out-written, out-argued and out-flamed
him in numerous public exchanges, in most of which Smith was finally
reduced to petty sniping and vitriolic, incoherent rage. Dr. Smith, who is
proud of his cleverness and learning and has a large Usenet ego, must be
very resentful that a person he finds so odious humiliates him in argument
after public argument.
Make no mistake about it: what we are seeing now, is an attempt by Dr Smith
to fight personal conflicts by professional means. This is despicable
behavior and should be condemned as such. Thousands of mathematicians,
including many people who are potentially my future employers and
colleagues, read sci.math. I suppose the same is true of Zeleny's future
employers (philosophers and logicians). Political arguments over subjects
like homosexuality are virtually unknown here, the set of non-lurkers
relatively small, and so accusations of bigotry against a couple of the
regulars are likely to be remembered for some time. As Dr Smith knows,
advancement in our field is largely a matter of social as well as
mathematical acceptability. Hence the attempt to discredit as "homophobes"
people whom he cannot punish by legitimate means. I have no interest in
taking legal action but I suppose a case could be made that this is libel.
Neither Zeleny nor I ever posted anything about homosexuality in this
thread or in sci.math. Neither of us had our names mentioned anywhere in
the thread to which Dr Smith replied. The present round of postings started
by Ludwig Plutonium's "gay" remark is, as far as I can remember, the first
time that the subjects of homosexuality and homophobia have ever been
broached on sci.math. (Ignoring some off-color humor in the threads on math
jokes). Dr Smith, therefore, is going out of his way to fight his personal
battles through professional means. I repeat: this is a despicable
practice and should be condemned as such.
As Allan Adler eloquently pointed out here in his postings on "Social
Harassment" a couple of years ago, mathematicians have a long way to go in
learning to separate their private and professional affairs. Dr Smith's
posting illustrates the downside of this situation.
The term 'homophobia' refers to a fear of homosexuals. Although
the leap from fear to bigotry against is both short and intuitive,
I believe someone can inform us of a more appropriate term for
bigotry based upon gender orientation. Regardless of what that
term might be, I doubt that is applies to the illustrious Ludwig
Plutonium who IMHO is too much of a charlatan to be a bigot.
IMHO, the phrase which most appropriately describes his comments
is 'social ignorance.'
Dick - All possible disclaimers apply
Say, do you believe everything you read? Would Dr Smith ever lie to you?
Erik, please indicate a single instance of "reactionary homophobia" or
similar "unacceptable behavior" in this newsgroup from anyone other than
Ludwig. Failing that, please concede that the above bit of moralizing is a
strawman. Failing that, consider yourself excommunicated from the category
of non-total-morons, and consider inveighing against such outrages in other
equally afflicted groups like comp.binaries.ibmpc.
Clue: apart from the last couple of days, I don't recall seeing even a
single reference to homosexuality in this newsgroup, phobic or otherwise.
I've been reading regularly for several years. The only things even
remotely similar were some remarks anti-affirmative action, and some debate
about the "Polly Nomial" story.
Tal Kubo
ku...@math.harvard.edu
---------------------------
Seen on Usenet:
>>America is a free country.
>Do you believe everything you misunderstand?
Not on sci.math. Here it means the irrational fear of homology.
Personally, I'm a cohomophile. :-)
--
Bradley W. Brock | "If I do, these persons may come to great harm....
br...@ccr-p.ida.org | After all a person's a person. No matter how small."
IDA/CCR Princeton, NJ | -Horton in "Horton Hears a Who!"
br...@alumni.cco.caltech.edu
> I'm curious: "homo" is latin for "human being" - is a homophobe a
> person who dislikes his own species?
Is it? Why do we have homomorphism, homogenous etc ?
(Just asking - the only latin I know I learnt as a child trying to relate
the left hand side of the prayer book to the right hand side (or was it
the
other way around)).
Michael.
-------------------------------------------------------------------------
Michael K. Murray
Pure Mathematics Department
University of Adelaide phone: (08) 303 4174
Adelaide SA 5005 fax: (08) 232 5670
AUSTRALIA. email: mmu...@spam.maths.adelaide.edu.au
-------------------------------------------------------------------------
|> (Just asking - the only latin I know I learnt as a child trying to relate
|> the left hand side of the prayer book to the right hand side (or was it
|> the
|> other way around)).
|>
|> Michael.
|> -------------------------------------------------------------------------
/-----------------------------------------------------------------------------\
| Have you got a little tartan | Richard Green (aka Edfromo) |
| drummer girl in a plastic tube? | Email: r...@uk.ac.warwick.maths |
| | (reverse this for internet) |
\-----------------------------------------------------------------------------/
Well, I'd say the problem you're having here is more due to the fact
that we aren't using latin roots in homophobia, homomorphism, homogeneous,
homogenized or any of many other such words.
homos is classical Greek for same.
phobos is classical Greek for fear.
morphe is classical Greek for form.
For geneous and genized, it's a bit harder since there are several classical
Greek words floating around here.
gignomai = to become, occur, happen. Its original stem is geno.
genesis = origin, source, race descent. It is related to gignomai.
There is a similar word: genos = race, descent, kind, species.
There are plenty of words in English created by smashing two Greek words
together (an activity the Greeks themselves were fond of). The words
above are examples of this.
Karen Condie Hunt
>Well, I'd say the problem you're having here is more due to the fact
>that we aren't using latin roots in homophobia, homomorphism, homogeneous,
>homogenized or any of many other such words.
>homos is classical Greek for same.
>phobos is classical Greek for fear.
>morphe is classical Greek for form.
>For geneous and genized, it's a bit harder since there are several classical
>Greek words floating around here.
>gignomai = to become, occur, happen. Its original stem is geno.
>genesis = origin, source, race descent. It is related to gignomai.
>There is a similar word: genos = race, descent, kind, species.
All the classical Greek "basic" terms (roots) mentioned above are also used
in modern Greek (their meaning remaining intact), with the exception of
"homos", which survived as "homios" (another ancient term for "similar").
>There are plenty of words in English created by smashing two Greek words
>together (an activity the Greeks themselves were fond of). The words
>above are examples of this.
"Homogeneous" is not one of them, however; indeed, the term existed
in classical Greek ("homogenees") meaning "from the same mother" or
"of the same kind". Consinstently with the remark made above,
"homogeneous" is used as "homiogenees" in modern Greek, with the
initial term ("homogenees") preserved either as a noun meaning
"Diaspora Greek" or ... as a Mathematical term :-)
>Karen Condie Hunt
George Baloglou--Mathematics, SUNY Oswego, NY 13126, USA
.............................................................
"But, aren't those shadowy, incomprehensibly large cardinals
at least as representative of contemporary Mathematics as
those prone-to-misprints large primes?"
.............................................................
> homogenous etc ?
> ^ Do we? I have 'homogeneous'.
> Or have I completely missed the point?
No homogenous is the Australian spelling (joke!)
>Of course, you are mixing Latin and Greek here (the "ph" in "morphism"
>should be a giveaway). But English-speakers have always done that; if
>not (as P. C. Patton once pointed out), an automobile would be known
>as either an "ipsemobile" or an "autokineton." (I like that last one!)
If memory serves me correctly, the modern Greek word for automobile
is autokineto. (And modern Greek for the planet Venus is "Aphrodite".)
Tom Ace
t...@netcom.com
A. De Paoli
RF>"autokineton." (I like that last one!)
In modern greek, it's "avtokineta" or something like that.
Hälsningar, ob
(Net)
OK, this time I cannot resist this one ... and here comes a 100%
non-mathematical posting--NO APOLOGIES OFFERED AFTER THIS WARNING!
In some sense, both posters are correct on the Greek word for
"automobile"; it is *written* in "Greek" as "autokivhtov" (with
"u" = ipsilon, "i" = iota, "h" = ita (all three *normally*
pronounced as "ee" in "peek") and "v" = nou) but pronounced as
"aftokiniton" (rather than "avtokiniton"). Where is the catch?
Well, when alpha is followed by upsilon, "au" is not pronounced
as "I", but either as "af" (when the *third* letter happens to be
"theta", "kappa", "ksi", "sigma", "tau", "phi", "chi") or as "av"
(when the *third* letter happens to be "alpha", "gamma", "delta",
"epsilon", "ita", "iota" (?), "lamda", "mou" (?), "nou", "omikron",
"rho", "omega"). [Notice: some of the combinations listed above
are extremely rare, even in ancient Greek; for details, check the
Liddell & Scott Greek-English Lexicon, Oxford, 1968, p. 274-285.]
Dimitri Vulis
CUNY GC Math
D...@CUNYVMS1.BITNET D...@CUNYVMS1.GC.CUNY.EDU
Disclaimer: my Usenet postings don't necessarily represent anyone's views,
especially my own and/or CUNY's.