Problem with STAR and fastq format
Luca Stefanucci
I am having trouble using star, in particular this command:
```ReadAlignChunk_processChunks.cpp:115:processChunks EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >```
This is the structure of the fastq file:
```
NTCGAATCTCTGGCTTGACACTACCTACTGGTGTCCAGTT
+HWI-ST230:1168:7:1101:1250:2076#ACTTGAA
#1=DDFDDHFHFHGGIGGEHGGEHIECGDEH?ECDHFHGF
@HWI-ST230:1168:7:1101:1400:2133#ACTTGAA
TATAAAGTGTTCTCGAGCCCGCTGCAAATGATCTAGACGC
+HWI-ST230:1168:7:1101:1400:2133#ACTTGAA
CCCFFFFDHHHHHJJJJJJJIJIJIIJJJJIJJJIJIJJJ
@HWI-ST230:1168:7:1101:1475:2176#ACTTGAA
GCTTGGTATTGCAGAGAAGATTTTATAAGAATTTTGCTTT
```
I tried to munge the data with ```sed -E '1n;1~3N;s/\+.+/\+/1'``` and I get this structure:
```
hiPSCHeps/0002755003733200026360000000000013462047733011342 5ustar rt7team204hiPSCHeps/hiPSCHeps_M3.fastq0000644003733200026361764372200413462047741014556 0ustar rt7team204@HWI-ST230:1168:7:1101:1250:2076#ACTTGAA
NTCGAATCTCTGGCTTGACACTACCTACTGGTGTCCAGTT
+
#1=DDFDDHFHFHGGIGGEHGGEHIECGDEH?ECDHFHGF
@HWI-ST230:1168:7:1101:1400:2133#ACTTGAA
TATAAAGTGTTCTCGAGCCCGCTGCAAATGATCTAGACGC
+
@HWI-ST230:1168:7:1101:1475:2176#ACTTGAA
GCTTGGTATTGCAGAGAAGATTTTATAAGAATTTTGCTTT
+
```
But even if I run on this new structure:
```STAR --runThreadN 8 --outStd SAM --outSAMtype BAM Unsorted --outSAMstrandField intronMotif --genomeDir $REFERENCE --readFilesIn $read1 ```
I get the same error
Do you have any suggestion?
I use star version STAR_2.5.0a
Best,
Luca
Alexander Dobin
Luca Stefanucci
Thanks for your answer.
I tried and it looks like is working. I get an Aligment.ou.bam file but I keep having the same error message and it exists.
Here the Log.out file:
STAR version=STAR_2.5.0a
STAR compilation time,server,dir=Sat Nov 7 13:54:13 EST 2015 modena.cshl.edu:/sonas-hs/gingeras/nlsas_norepl/user/dobin/STAR/STAR.sandbox/source
##### DEFAULT parameters:
versionSTAR 20201
versionGenome 20101 20200
parametersFiles -
sysShell -
runMode alignReads
runThreadN 1
runDirPerm User_RWX
runRNGseed 777
genomeDir ./GenomeDir/
genomeLoad NoSharedMemory
genomeFastaFiles -
genomeSAindexNbases 14
genomeChrBinNbits 18
genomeSAsparseD 1
readFilesIn Read1 Read2
readFilesCommand -
readMatesLengthsIn NotEqual
readMapNumber 18446744073709551615
readNameSeparator /
inputBAMfile -
bamRemoveDuplicatesType -
bamRemoveDuplicatesMate2basesN 0
limitGenomeGenerateRAM 31000000000
limitIObufferSize 150000000
limitOutSAMoneReadBytes 100000
limitOutSJcollapsed 1000000
limitOutSJoneRead 1000
limitBAMsortRAM 0
limitSjdbInsertNsj 1000000
outFileNamePrefix ./
outTmpDir -
outReadsUnmapped None
outQSconversionAdd 0
outMultimapperOrder Old_2.4
outSAMtype SAM
outSAMmode Full
outSAMstrandField None
outSAMattributes Standard
outSAMunmapped None
outSAMorder Paired
outSAMprimaryFlag OneBestScore
outSAMreadID Standard
outSAMmapqUnique 255
outSAMflagOR 0
outSAMflagAND 65535
outSAMattrRGline -
outSAMheaderHD -
outSAMheaderPG -
outSAMheaderCommentFile -
outBAMcompression 1
outBAMsortingThreadN 0
outSAMfilter None
outSAMmultNmax 18446744073709551615
outSAMattrIHstart 1
outSJfilterReads All
outSJfilterCountUniqueMin 3 1 1 1
outSJfilterCountTotalMin 3 1 1 1
outSJfilterOverhangMin 30 12 12 12
outSJfilterDistToOtherSJmin 10 0 5 10
outSJfilterIntronMaxVsReadN 50000 100000 200000
outWigType None
outWigStrand Stranded
outWigReferencesPrefix -
outWigNorm RPM
outFilterType Normal
outFilterMultimapNmax 10
outFilterMultimapScoreRange 1
outFilterScoreMin 0
outFilterScoreMinOverLread 0.66
outFilterMatchNmin 0
outFilterMatchNminOverLread 0.66
outFilterMismatchNmax 10
outFilterMismatchNoverLmax 0.3
outFilterMismatchNoverReadLmax 1
outFilterIntronMotifs None
clip5pNbases 0
clip3pNbases 0
clip3pAfterAdapterNbases 0
clip3pAdapterSeq -
clip3pAdapterMMp 0.1
winBinNbits 16
winAnchorDistNbins 9
winFlankNbins 4
winAnchorMultimapNmax 50
scoreGap 0
scoreGapNoncan -8
scoreGapGCAG -4
scoreGapATAC -8
scoreStitchSJshift 1
scoreGenomicLengthLog2scale -0.25
scoreDelBase -2
scoreDelOpen -2
scoreInsOpen -2
scoreInsBase -2
seedSearchLmax 0
seedSearchStartLmax 50
seedSearchStartLmaxOverLread 1
seedPerReadNmax 1000
seedPerWindowNmax 50
seedNoneLociPerWindow 10
seedMultimapNmax 10000
alignIntronMin 21
alignIntronMax 0
alignMatesGapMax 0
alignTranscriptsPerReadNmax 10000
alignSJoverhangMin 5
alignSJDBoverhangMin 3
alignSJstitchMismatchNmax 0 -1 0 0
alignSplicedMateMapLmin 0
alignSplicedMateMapLminOverLmate 0.66
alignWindowsPerReadNmax 10000
alignTranscriptsPerWindowNmax 100
alignEndsType Local
alignSoftClipAtReferenceEnds Yes
chimSegmentMin 0
chimScoreMin 0
chimScoreDropMax 20
chimScoreSeparation 10
chimScoreJunctionNonGTAG -1
chimJunctionOverhangMin 20
chimOutType SeparateSAMold
chimFilter banGenomicN
chimSegmentReadGapMax 0
sjdbFileChrStartEnd -
sjdbGTFfile -
sjdbGTFchrPrefix -
sjdbGTFfeatureExon exon
sjdbGTFtagExonParentTranscript transcript_id
sjdbGTFtagExonParentGene gene_id
sjdbOverhang 100
sjdbScore 2
sjdbInsertSave Basic
quantMode -
quantTranscriptomeBAMcompression 1
quantTranscriptomeBan IndelSoftclipSingleend
twopass1readsN 18446744073709551615
twopassMode None
##### Command Line:
STAR --runThreadN 8 --outStd SAM --outSAMtype BAM Unsorted --outSAMstrandField intronMotif --genomeDir /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/star_reference_hg38 --readFilesIn /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/RNA_ESPRESSION_VALUES/RNA-Seq_data_Hepatocytes_Rute_Ludovic_Vallier/ORIGINAL_tar.gz_from_RUTE/hiPSCHepsRNAseq
##### Initial USER parameters from Command Line:
outStd SAM
###### All USER parameters from Command Line:
runThreadN 8 ~RE-DEFINED
outStd SAM ~RE-DEFINED
outSAMtype BAM Unsorted ~RE-DEFINED
outSAMstrandField intronMotif ~RE-DEFINED
genomeDir /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/star_reference_hg38 ~RE-DEFINED
readFilesIn /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/RNA_ESPRESSION_VALUES/RNA-Seq_data_Hepatocytes_Rute_Ludovic_Vallier/ORIGINAL_tar.gz_from_RUTE/hiPSCHepsRNAseq ~RE-DEFINED
##### Finished reading parameters from all sources
##### Final user re-defined parameters-----------------:
runThreadN 8
genomeDir /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/star_reference_hg38
readFilesIn /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/RNA_ESPRESSION_VALUES/RNA-Seq_data_Hepatocytes_Rute_Ludovic_Vallier/ORIGINAL_tar.gz_from_RUTE/hiPSCHepsRNAseq
outStd SAM
outSAMtype BAM Unsorted
outSAMstrandField intronMotif
-------------------------------
##### Final effective command line:
STAR --runThreadN 8 --genomeDir /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/star_reference_hg38 --readFilesIn /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/RNA_ESPRESSION_VALUES/RNA-Seq_data_Hepatocytes_Rute_Ludovic_Vallier/ORIGINAL_tar.gz_from_RUTE/hiPSCHepsRNAseq --outStd SAM --outSAMtype BAM Unsorted --outSAMstrandField intronMotif
##### Final parameters after user input--------------------------------:
versionSTAR 20201
versionGenome 20101 20200
parametersFiles -
sysShell -
runMode alignReads
runThreadN 8
runDirPerm User_RWX
runRNGseed 777
genomeDir /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/star_reference_hg38
genomeLoad NoSharedMemory
genomeFastaFiles -
genomeSAindexNbases 14
genomeChrBinNbits 18
genomeSAsparseD 1
readFilesIn /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/RNA_ESPRESSION_VALUES/RNA-Seq_data_Hepatocytes_Rute_Ludovic_Vallier/ORIGINAL_tar.gz_from_RUTE/hiPSCHepsRNAseq
readFilesCommand -
readMatesLengthsIn NotEqual
readMapNumber 18446744073709551615
readNameSeparator /
inputBAMfile -
bamRemoveDuplicatesType -
bamRemoveDuplicatesMate2basesN 0
limitGenomeGenerateRAM 31000000000
limitIObufferSize 150000000
limitOutSAMoneReadBytes 100000
limitOutSJcollapsed 1000000
limitOutSJoneRead 1000
limitBAMsortRAM 0
limitSjdbInsertNsj 1000000
outFileNamePrefix ./
outTmpDir -
outStd SAM
outReadsUnmapped None
outQSconversionAdd 0
outMultimapperOrder Old_2.4
outSAMtype BAM Unsorted
outSAMmode Full
outSAMstrandField intronMotif
outSAMattributes Standard
outSAMunmapped None
outSAMorder Paired
outSAMprimaryFlag OneBestScore
outSAMreadID Standard
outSAMmapqUnique 255
outSAMflagOR 0
outSAMflagAND 65535
outSAMattrRGline -
outSAMheaderHD -
outSAMheaderPG -
outSAMheaderCommentFile -
outBAMcompression 1
outBAMsortingThreadN 0
outSAMfilter None
outSAMmultNmax 18446744073709551615
outSAMattrIHstart 1
outSJfilterReads All
outSJfilterCountUniqueMin 3 1 1 1
outSJfilterCountTotalMin 3 1 1 1
outSJfilterOverhangMin 30 12 12 12
outSJfilterDistToOtherSJmin 10 0 5 10
outSJfilterIntronMaxVsReadN 50000 100000 200000
outWigType None
outWigStrand Stranded
outWigReferencesPrefix -
outWigNorm RPM
outFilterType Normal
outFilterMultimapNmax 10
outFilterMultimapScoreRange 1
outFilterScoreMin 0
outFilterScoreMinOverLread 0.66
outFilterMatchNmin 0
outFilterMatchNminOverLread 0.66
outFilterMismatchNmax 10
outFilterMismatchNoverLmax 0.3
outFilterMismatchNoverReadLmax 1
outFilterIntronMotifs None
clip5pNbases 0
clip3pNbases 0
clip3pAfterAdapterNbases 0
clip3pAdapterSeq -
clip3pAdapterMMp 0.1
winBinNbits 16
winAnchorDistNbins 9
winFlankNbins 4
winAnchorMultimapNmax 50
scoreGap 0
scoreGapNoncan -8
scoreGapGCAG -4
scoreGapATAC -8
scoreStitchSJshift 1
scoreGenomicLengthLog2scale -0.25
scoreDelBase -2
scoreDelOpen -2
scoreInsOpen -2
scoreInsBase -2
seedSearchLmax 0
seedSearchStartLmax 50
seedSearchStartLmaxOverLread 1
seedPerReadNmax 1000
seedPerWindowNmax 50
seedNoneLociPerWindow 10
seedMultimapNmax 10000
alignIntronMin 21
alignIntronMax 0
alignMatesGapMax 0
alignTranscriptsPerReadNmax 10000
alignSJoverhangMin 5
alignSJDBoverhangMin 3
alignSJstitchMismatchNmax 0 -1 0 0
alignSplicedMateMapLmin 0
alignSplicedMateMapLminOverLmate 0.66
alignWindowsPerReadNmax 10000
alignTranscriptsPerWindowNmax 100
alignEndsType Local
alignSoftClipAtReferenceEnds Yes
chimSegmentMin 0
chimScoreMin 0
chimScoreDropMax 20
chimScoreSeparation 10
chimScoreJunctionNonGTAG -1
chimJunctionOverhangMin 20
chimOutType SeparateSAMold
chimFilter banGenomicN
chimSegmentReadGapMax 0
sjdbFileChrStartEnd -
sjdbGTFfile -
sjdbGTFchrPrefix -
sjdbGTFfeatureExon exon
sjdbGTFtagExonParentTranscript transcript_id
sjdbGTFtagExonParentGene gene_id
sjdbOverhang 100
sjdbScore 2
sjdbInsertSave Basic
quantMode -
quantTranscriptomeBAMcompression 1
quantTranscriptomeBan IndelSoftclipSingleend
twopass1readsN 18446744073709551615
twopassMode None
----------------------------------------
WARNING --outSAMstrandField=intronMotif, therefore STAR will output XS attribute
Finished loading and checking parameters
Reading genome generation parameters:
versionGenome 20201 ~RE-DEFINED
genomeFastaFiles /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/HG38_FROM_ILLUMINA/Homo_sapiens/UCSC/hg38/Sequence/WholeGenomeFasta/genome.fa ~RE-DEFINED
genomeSAindexNbases 14 ~RE-DEFINED
genomeChrBinNbits 18 ~RE-DEFINED
genomeSAsparseD 1 ~RE-DEFINED
sjdbOverhang 99 ~RE-DEFINED
sjdbFileChrStartEnd - ~RE-DEFINED
sjdbGTFfile /home/ls760/rds/rds-who1000-cbrc/analysis/bp_epigenomes/ls760/Luca_Hi-C/REFERENCES/GENOME_REFERENCES_FOR_hg38/HG38_FROM_ILLUMINA/Homo_sapiens/UCSC/hg38/Annotation/Genes/genes.gtf ~RE-DEFINED
sjdbGTFchrPrefix - ~RE-DEFINED
sjdbGTFfeatureExon exon ~RE-DEFINED
sjdbGTFtagExonParentTranscripttranscript_id ~RE-DEFINED
sjdbGTFtagExonParentGene gene_id ~RE-DEFINED
sjdbInsertSave Basic ~RE-DEFINED
Genome version is compatible with current STAR version
Number of real (reference) chromosmes= 195
1 chr1 248956422 0
2 chr2 242193529 249036800
3 chr3 198295559 491257856
4 chr4 190214555 689700864
5 chr5 181538259 880017408
6 chr6 170805979 1061683200
7 chr7 159345973 1232601088
8 chr8 145138636 1391984640
9 chr9 138394717 1537212416
10 chr10 133797422 1675624448
11 chr11 135086622 1809580032
12 chr12 133275309 1944846336
13 chr13 114364328 2078277632
14 chr14 107043718 2192834560
15 chr15 101991189 2300051456
16 chr16 90338345 2402287616
17 chr17 83257441 2492727296
18 chr18 80373285 2576089088
19 chr19 58617616 2656567296
20 chr20 64444167 2715287552
21 chr21 46709983 2779774976
22 chr22 50818468 2826698752
23 chrX 156040895 2877554688
24 chrY 57227415 3033792512
25 chrM 16569 3091202048
26 chr1_KI270706v1_random 175055 3091464192
27 chr1_KI270707v1_random 32032 3091726336
28 chr1_KI270708v1_random 127682 3091988480
29 chr1_KI270709v1_random 66860 3092250624
30 chr1_KI270710v1_random 40176 3092512768
31 chr1_KI270711v1_random 42210 3092774912
32 chr1_KI270712v1_random 176043 3093037056
33 chr1_KI270713v1_random 40745 3093299200
34 chr1_KI270714v1_random 41717 3093561344
35 chr2_KI270715v1_random 161471 3093823488
36 chr2_KI270716v1_random 153799 3094085632
37 chr3_GL000221v1_random 155397 3094347776
38 chr4_GL000008v2_random 209709 3094609920
39 chr5_GL000208v1_random 92689 3094872064
40 chr9_KI270717v1_random 40062 3095134208
41 chr9_KI270718v1_random 38054 3095396352
42 chr9_KI270719v1_random 176845 3095658496
43 chr9_KI270720v1_random 39050 3095920640
44 chr11_KI270721v1_random 100316 3096182784
45 chr14_GL000009v2_random 201709 3096444928
46 chr14_GL000225v1_random 211173 3096707072
47 chr14_KI270722v1_random 194050 3096969216
48 chr14_GL000194v1_random 191469 3097231360
49 chr14_KI270723v1_random 38115 3097493504
50 chr14_KI270724v1_random 39555 3097755648
51 chr14_KI270725v1_random 172810 3098017792
52 chr14_KI270726v1_random 43739 3098279936
53 chr15_KI270727v1_random 448248 3098542080
54 chr16_KI270728v1_random 1872759 3099066368
55 chr17_GL000205v2_random 185591 3101163520
56 chr17_KI270729v1_random 280839 3101425664
57 chr17_KI270730v1_random 112551 3101949952
58 chr22_KI270731v1_random 150754 3102212096
59 chr22_KI270732v1_random 41543 3102474240
60 chr22_KI270733v1_random 179772 3102736384
61 chr22_KI270734v1_random 165050 3102998528
62 chr22_KI270735v1_random 42811 3103260672
63 chr22_KI270736v1_random 181920 3103522816
64 chr22_KI270737v1_random 103838 3103784960
65 chr22_KI270738v1_random 99375 3104047104
66 chr22_KI270739v1_random 73985 3104309248
67 chrY_KI270740v1_random 37240 3104571392
68 chrUn_KI270302v1 2274 3104833536
69 chrUn_KI270304v1 2165 3105095680
70 chrUn_KI270303v1 1942 3105357824
71 chrUn_KI270305v1 1472 3105619968
72 chrUn_KI270322v1 21476 3105882112
73 chrUn_KI270320v1 4416 3106144256
74 chrUn_KI270310v1 1201 3106406400
75 chrUn_KI270316v1 1444 3106668544
76 chrUn_KI270315v1 2276 3106930688
77 chrUn_KI270312v1 998 3107192832
78 chrUn_KI270311v1 12399 3107454976
79 chrUn_KI270317v1 37690 3107717120
80 chrUn_KI270412v1 1179 3107979264
81 chrUn_KI270411v1 2646 3108241408
82 chrUn_KI270414v1 2489 3108503552
83 chrUn_KI270419v1 1029 3108765696
84 chrUn_KI270418v1 2145 3109027840
85 chrUn_KI270420v1 2321 3109289984
86 chrUn_KI270424v1 2140 3109552128
87 chrUn_KI270417v1 2043 3109814272
88 chrUn_KI270422v1 1445 3110076416
89 chrUn_KI270423v1 981 3110338560
90 chrUn_KI270425v1 1884 3110600704
91 chrUn_KI270429v1 1361 3110862848
92 chrUn_KI270442v1 392061 3111124992
93 chrUn_KI270466v1 1233 3111649280
94 chrUn_KI270465v1 1774 3111911424
95 chrUn_KI270467v1 3920 3112173568
96 chrUn_KI270435v1 92983 3112435712
97 chrUn_KI270438v1 112505 3112697856
98 chrUn_KI270468v1 4055 3112960000
99 chrUn_KI270510v1 2415 3113222144
100 chrUn_KI270509v1 2318 3113484288
101 chrUn_KI270518v1 2186 3113746432
102 chrUn_KI270508v1 1951 3114008576
103 chrUn_KI270516v1 1300 3114270720
104 chrUn_KI270512v1 22689 3114532864
105 chrUn_KI270519v1 138126 3114795008
106 chrUn_KI270522v1 5674 3115057152
107 chrUn_KI270511v1 8127 3115319296
108 chrUn_KI270515v1 6361 3115581440
109 chrUn_KI270507v1 5353 3115843584
110 chrUn_KI270517v1 3253 3116105728
111 chrUn_KI270529v1 1899 3116367872
112 chrUn_KI270528v1 2983 3116630016
113 chrUn_KI270530v1 2168 3116892160
114 chrUn_KI270539v1 993 3117154304
115 chrUn_KI270538v1 91309 3117416448
116 chrUn_KI270544v1 1202 3117678592
117 chrUn_KI270548v1 1599 3117940736
118 chrUn_KI270583v1 1400 3118202880
119 chrUn_KI270587v1 2969 3118465024
120 chrUn_KI270580v1 1553 3118727168
121 chrUn_KI270581v1 7046 3118989312
122 chrUn_KI270579v1 31033 3119251456
123 chrUn_KI270589v1 44474 3119513600
124 chrUn_KI270590v1 4685 3119775744
125 chrUn_KI270584v1 4513 3120037888
126 chrUn_KI270582v1 6504 3120300032
127 chrUn_KI270588v1 6158 3120562176
128 chrUn_KI270593v1 3041 3120824320
129 chrUn_KI270591v1 5796 3121086464
130 chrUn_KI270330v1 1652 3121348608
131 chrUn_KI270329v1 1040 3121610752
132 chrUn_KI270334v1 1368 3121872896
133 chrUn_KI270333v1 2699 3122135040
134 chrUn_KI270335v1 1048 3122397184
135 chrUn_KI270338v1 1428 3122659328
136 chrUn_KI270340v1 1428 3122921472
137 chrUn_KI270336v1 1026 3123183616
138 chrUn_KI270337v1 1121 3123445760
139 chrUn_KI270363v1 1803 3123707904
140 chrUn_KI270364v1 2855 3123970048
141 chrUn_KI270362v1 3530 3124232192
142 chrUn_KI270366v1 8320 3124494336
143 chrUn_KI270378v1 1048 3124756480
144 chrUn_KI270379v1 1045 3125018624
145 chrUn_KI270389v1 1298 3125280768
146 chrUn_KI270390v1 2387 3125542912
147 chrUn_KI270387v1 1537 3125805056
148 chrUn_KI270395v1 1143 3126067200
149 chrUn_KI270396v1 1880 3126329344
150 chrUn_KI270388v1 1216 3126591488
151 chrUn_KI270394v1 970 3126853632
152 chrUn_KI270386v1 1788 3127115776
153 chrUn_KI270391v1 1484 3127377920
154 chrUn_KI270383v1 1750 3127640064
155 chrUn_KI270393v1 1308 3127902208
156 chrUn_KI270384v1 1658 3128164352
157 chrUn_KI270392v1 971 3128426496
158 chrUn_KI270381v1 1930 3128688640
159 chrUn_KI270385v1 990 3128950784
160 chrUn_KI270382v1 4215 3129212928
161 chrUn_KI270376v1 1136 3129475072
162 chrUn_KI270374v1 2656 3129737216
163 chrUn_KI270372v1 1650 3129999360
164 chrUn_KI270373v1 1451 3130261504
165 chrUn_KI270375v1 2378 3130523648
166 chrUn_KI270371v1 2805 3130785792
167 chrUn_KI270448v1 7992 3131047936
168 chrUn_KI270521v1 7642 3131310080
169 chrUn_GL000195v1 182896 3131572224
170 chrUn_GL000219v1 179198 3131834368
171 chrUn_GL000220v1 161802 3132096512
172 chrUn_GL000224v1 179693 3132358656
173 chrUn_KI270741v1 157432 3132620800
174 chrUn_GL000226v1 15008 3132882944
175 chrUn_GL000213v1 164239 3133145088
176 chrUn_KI270743v1 210658 3133407232
177 chrUn_KI270744v1 168472 3133669376
178 chrUn_KI270745v1 41891 3133931520
179 chrUn_KI270746v1 66486 3134193664
180 chrUn_KI270747v1 198735 3134455808
181 chrUn_KI270748v1 93321 3134717952
182 chrUn_KI270749v1 158759 3134980096
183 chrUn_KI270750v1 148850 3135242240
184 chrUn_KI270751v1 150742 3135504384
185 chrUn_KI270752v1 27745 3135766528
186 chrUn_KI270753v1 62944 3136028672
187 chrUn_KI270754v1 40191 3136290816
188 chrUn_KI270755v1 36723 3136552960
189 chrUn_KI270756v1 79590 3136815104
190 chrUn_KI270757v1 71251 3137077248
191 chrUn_GL000214v1 137718 3137339392
192 chrUn_KI270742v1 186739 3137601536
193 chrUn_GL000216v2 176608 3137863680
194 chrUn_GL000218v1 161147 3138125824
195 chrEBV 171823 3138387968
--sjdbOverhang = 99 taken from the generated genome
Started loading the genome: Sat Mar 7 08:44:31 2020
checking Genome sizefile size: 3183474663 bytes; state: good=1 eof=0 fail=0 bad=0
checking SA sizefile size: 24580371135 bytes; state: good=1 eof=0 fail=0 bad=0
checking /SAindex sizefile size: 1565873619 bytes; state: good=1 eof=0 fail=0 bad=0
Read from SAindex: genomeSAindexNbases=14 nSAi=357913940
nGenome=3183474663; nSAbyte=24580371135
GstrandBit=32 SA number of indices=5958877850
Shared memory is not used for genomes. Allocated a private copy of the genome.
Genome file size: 3183474663 bytes; state: good=1 eof=0 fail=0 bad=0
Loading Genome ... done! state: good=1 eof=0 fail=0 bad=0; loaded 3183474663 bytes
SA file size: 24580371135 bytes; state: good=1 eof=0 fail=0 bad=0
Loading SA ... done! state: good=1 eof=0 fail=0 bad=0; loaded 24580371135 bytes
Loading SAindex ... done: 1565873619 bytes
Finished loading the genome: Sat Mar 7 10:49:09 2020
Processing splice junctions database sjdbN=225249, sjdbOverhang=99
alignIntronMax=alignMatesGapMax=0, the max intron size will be approximately determined by (2^winBinNbits)*winAnchorDistNbins=589824
Created thread # 1
Created thread # 2
Created thread # 3
Created thread # 4
Created thread # 5
Created thread # 6
Created thread # 7
ReadAlignChunk_processChunks.cpp:115:processChunks EXITING because of FATAL ERROR in input reads: unknown file format: the read ID should start with @ or >
Mar 07 10:54:39 ...... FATAL ERROR, exiting
```