STAR aligner is stuck after "Finished loading and checking parameters" in "Log.out"
61 views
Skip to first unread message
Josh Espinoza
Jan 16, 2019, 5:46:05 PM1/16/19
to rna-star
I'm running the Dropseq pipeline and STAR aligner is getting stuck. I can't figure out why. Is there a way to monitor the progress or to see which part it is stuck on? I'm running it for a test dataset and it worked before in about 2 minutes but now it's not working for some reason.
(bbmap_env) -bash-4.1$ ls -lhtr dropseq_output/testing/
total 15M
-rw-r--r-- 1 jespinoz tigr 0 Jan 16 17:30 commands.sh
-rw-r--r-- 1 jespinoz tigr 1.5M Jan 16 17:30 unaligned_data.bam
-rw-r--r-- 1 jespinoz tigr 1.7M Jan 16 17:31 unaligned_tagged_Cell.bam
-rw-r--r-- 1 jespinoz tigr 90 Jan 16 17:31 unaligned_tagged_Cell.bam_summary.txt
-rw-r--r-- 1 jespinoz tigr 1.4M Jan 16 17:31 unaligned_tagged_CellMolecular.bam
-rw-r--r-- 1 jespinoz tigr 70 Jan 16 17:31 unaligned_tagged_CellMolecular.bam_summary.txt
-rw-r--r-- 1 jespinoz tigr 1.4M Jan 16 17:31 unaligned_tagged_filtered.bam
-rw-r--r-- 1 jespinoz tigr 1.4M Jan 16 17:31 unaligned_tagged_trimmed_smart.bam
-rw-r--r-- 1 jespinoz tigr 265 Jan 16 17:31 adapter_trimming_report.txt
-rw-r--r-- 1 jespinoz tigr 1.4M Jan 16 17:31 unaligned_mc_tagged_polyA_filtered.bam
-rw-r--r-- 1 jespinoz tigr 474 Jan 16 17:31 polyA_trimming_report.txt
-rw-r--r-- 1 jespinoz tigr 3.6M Jan 16 17:31 unaligned_mc_tagged_polyA_filtered.fastq
drwxr-xr-x 2 jespinoz tigr 358 Jan 16 17:31 progress
-rw-r--r-- 1 jespinoz tigr 14K Jan 16 17:31 log.e
-rw-r--r-- 1 jespinoz tigr 14K Jan 16 17:31 log.o
drwx------ 2 jespinoz tigr 0 Jan 16 17:31 star__STARtmp
-rw-r--r-- 1 jespinoz tigr 0 Jan 16 17:31 star_Log.progress.out
-rw-r--r-- 1 jespinoz tigr 0 Jan 16 17:31 star_Aligned.out.sam
-rw-r--r-- 1 jespinoz tigr 15K Jan 16 17:31 star_Log.outHere's the results of my mapping log.
bash-4.1$ cat dropseq_output/testing/star_Log.out
STAR version=STAR_2.6.1a_08-27
STAR compilation time,server,dir=Mon Aug 27 18:20:13 EDT 2018 florence.cshl.edu:/sonas-hs/gingeras/nlsas_norepl/user/dobin/STAR/STAR.master/source
##### DEFAULT parameters:
versionSTAR 20201
versionGenome 20101 20200
parametersFiles -
sysShell -
runMode alignReads
runThreadN 1
runDirPerm User_RWX
runRNGseed 777
genomeDir ./GenomeDir/
genomeLoad NoSharedMemory
genomeFastaFiles -
genomeChainFiles -
genomeSAindexNbases 14
genomeChrBinNbits 18
genomeSAsparseD 1
genomeSuffixLengthMax 18446744073709551615
genomeFileSizes 0
genomeConsensusFile -
readFilesType Fastx
readFilesIn Read1 Read2
readFilesPrefix -
readFilesCommand -
readMatesLengthsIn NotEqual
readMapNumber 18446744073709551615
readNameSeparator /
inputBAMfile -
bamRemoveDuplicatesType -
bamRemoveDuplicatesMate2basesN 0
limitGenomeGenerateRAM 31000000000
limitIObufferSize 150000000
limitOutSAMoneReadBytes 100000
limitOutSJcollapsed 1000000
limitOutSJoneRead 1000
limitBAMsortRAM 0
limitSjdbInsertNsj 1000000
outTmpDir -
outTmpKeep None
outStd Log
outReadsUnmapped None
outQSconversionAdd 0
outMultimapperOrder Old_2.4
outSAMtype SAM
outSAMmode Full
outSAMstrandField None
outSAMattributes Standard
outSAMunmapped None
outSAMorder Paired
outSAMprimaryFlag OneBestScore
outSAMreadID Standard
outSAMmapqUnique 255
outSAMflagOR 0
outSAMflagAND 65535
outSAMattrRGline -
outSAMheaderHD -
outSAMheaderPG -
outSAMheaderCommentFile -
outBAMcompression 1
outBAMsortingThreadN 0
outBAMsortingBinsN 50
outSAMfilter None
outSAMmultNmax 18446744073709551615
outSAMattrIHstart 1
outSAMtlen 1
outSJfilterReads All
outSJfilterCountUniqueMin 3 1 1 1
outSJfilterCountTotalMin 3 1 1 1
outSJfilterOverhangMin 30 12 12 12
outSJfilterDistToOtherSJmin 10 0 5 10
outSJfilterIntronMaxVsReadN 50000 100000 200000
outWigType None
outWigStrand Stranded
outWigReferencesPrefix -
outWigNorm RPM
outFilterType Normal
outFilterMultimapNmax 10
outFilterMultimapScoreRange 1
outFilterScoreMin 0
outFilterScoreMinOverLread 0.66
outFilterMatchNmin 0
outFilterMatchNminOverLread 0.66
outFilterMismatchNmax 10
outFilterMismatchNoverLmax 0.3
outFilterMismatchNoverReadLmax 1
outFilterIntronMotifs None
outFilterIntronStrands RemoveInconsistentStrands
clip5pNbases 0
clip3pNbases 0
clip3pAfterAdapterNbases 0
clip3pAdapterSeq -
clip3pAdapterMMp 0.1
winBinNbits 16
winAnchorDistNbins 9
winFlankNbins 4
winAnchorMultimapNmax 50
winReadCoverageRelativeMin 0.5
winReadCoverageBasesMin 0
scoreGap 0
scoreGapNoncan -8
scoreGapGCAG -4
scoreGapATAC -8
scoreStitchSJshift 1
scoreGenomicLengthLog2scale -0.25
scoreDelBase -2
scoreDelOpen -2
scoreInsOpen -2
scoreInsBase -2
seedSearchLmax 0
seedSearchStartLmax 50
seedSearchStartLmaxOverLread 1
seedPerReadNmax 1000
seedPerWindowNmax 50
seedNoneLociPerWindow 10
seedMultimapNmax 10000
seedSplitMin 12
alignIntronMin 21
alignIntronMax 0
alignMatesGapMax 0
alignTranscriptsPerReadNmax 10000
alignSJoverhangMin 5
alignSJDBoverhangMin 3
alignSJstitchMismatchNmax 0 -1 0 0
alignSplicedMateMapLmin 0
alignSplicedMateMapLminOverLmate 0.66
alignWindowsPerReadNmax 10000
alignTranscriptsPerWindowNmax 100
alignEndsType Local
alignSoftClipAtReferenceEnds Yes
alignEndsProtrude 0 ConcordantPair
alignInsertionFlush None
peOverlapNbasesMin 0
peOverlapMMp 0.01
chimSegmentMin 0
chimScoreMin 0
chimScoreDropMax 20
chimScoreSeparation 10
chimScoreJunctionNonGTAG -1
chimMainSegmentMultNmax 10
chimJunctionOverhangMin 20
chimOutType Junctions
chimFilter banGenomicN
chimSegmentReadGapMax 0
chimMultimapNmax 0
chimMultimapScoreRange 1
chimNonchimScoreDropMin 20
chimOutJunctionFormat 0
sjdbFileChrStartEnd -
sjdbGTFfile -
sjdbGTFchrPrefix -
sjdbGTFfeatureExon exon
sjdbGTFtagExonParentTranscript transcript_id
sjdbGTFtagExonParentGene gene_id
sjdbOverhang 100
sjdbScore 2
sjdbInsertSave Basic
varVCFfile -
waspOutputMode None
quantMode -
quantTranscriptomeBAMcompression 1
quantTranscriptomeBan IndelSoftclipSingleend
twopass1readsN 18446744073709551615
twopassMode None
##### Command Line:
/usr/local/devel/ANNOTATION/jespinoz/anaconda/envs/dropseq_env/bin/STAR --genomeDir /usr/local/projdata/0568/projects/PLANKTON/illumina_aallen/jmccrow/Drop-seq_Lisa/STAR --readFilesIn dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq --outFileNamePrefix dropseq_output/testing/star_ --runThreadN 1
##### Initial USER parameters from Command Line:
outFileNamePrefix dropseq_output/testing/star_
###### All USER parameters from Command Line:
genomeDir /usr/local/projdata/0568/projects/PLANKTON/illumina_aallen/jmccrow/Drop-seq_Lisa/STAR ~RE-DEFINED
readFilesIn dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq ~RE-DEFINED
outFileNamePrefix dropseq_output/testing/star_ ~RE-DEFINED
runThreadN 1 ~RE-DEFINED
##### Finished reading parameters from all sources
##### Final user re-defined parameters-----------------:
runThreadN 1
genomeDir /usr/local/projdata/0568/projects/PLANKTON/illumina_aallen/jmccrow/Drop-seq_Lisa/STAR
readFilesIn dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq
outFileNamePrefix dropseq_output/testing/star_
-------------------------------
##### Final effective command line:
/usr/local/devel/ANNOTATION/jespinoz/anaconda/envs/dropseq_env/bin/STAR --runThreadN 1 --genomeDir /usr/local/projdata/0568/projects/PLANKTON/illumina_aallen/jmccrow/Drop-seq_Lisa/STAR --readFilesIn dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq --outFileNamePrefix dropseq_output/testing/star_
##### Final parameters after user input--------------------------------:
versionSTAR 20201
versionGenome 20101 20200
parametersFiles -
sysShell -
runMode alignReads
runThreadN 1
runDirPerm User_RWX
runRNGseed 777
genomeDir /usr/local/projdata/0568/projects/PLANKTON/illumina_aallen/jmccrow/Drop-seq_Lisa/STAR
genomeLoad NoSharedMemory
genomeFastaFiles -
genomeChainFiles -
genomeSAindexNbases 14
genomeChrBinNbits 18
genomeSAsparseD 1
genomeSuffixLengthMax 18446744073709551615
genomeFileSizes 0
genomeConsensusFile -
readFilesType Fastx
readFilesIn dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq
readFilesPrefix -
readFilesCommand -
readMatesLengthsIn NotEqual
readMapNumber 18446744073709551615
readNameSeparator /
inputBAMfile -
bamRemoveDuplicatesType -
bamRemoveDuplicatesMate2basesN 0
limitGenomeGenerateRAM 31000000000
limitIObufferSize 150000000
limitOutSAMoneReadBytes 100000
limitOutSJcollapsed 1000000
limitOutSJoneRead 1000
limitBAMsortRAM 0
limitSjdbInsertNsj 1000000
outFileNamePrefix dropseq_output/testing/star_
outTmpDir -
outTmpKeep None
outStd Log
outReadsUnmapped None
outQSconversionAdd 0
outMultimapperOrder Old_2.4
outSAMtype SAM
outSAMmode Full
outSAMstrandField None
outSAMattributes Standard
outSAMunmapped None
outSAMorder Paired
outSAMprimaryFlag OneBestScore
outSAMreadID Standard
outSAMmapqUnique 255
outSAMflagOR 0
outSAMflagAND 65535
outSAMattrRGline -
outSAMheaderHD -
outSAMheaderPG -
outSAMheaderCommentFile -
outBAMcompression 1
outBAMsortingThreadN 0
outBAMsortingBinsN 50
outSAMfilter None
outSAMmultNmax 18446744073709551615
outSAMattrIHstart 1
outSAMtlen 1
outSJfilterReads All
outSJfilterCountUniqueMin 3 1 1 1
outSJfilterCountTotalMin 3 1 1 1
outSJfilterOverhangMin 30 12 12 12
outSJfilterDistToOtherSJmin 10 0 5 10
outSJfilterIntronMaxVsReadN 50000 100000 200000
outWigType None
outWigStrand Stranded
outWigReferencesPrefix -
outWigNorm RPM
outFilterType Normal
outFilterMultimapNmax 10
outFilterMultimapScoreRange 1
outFilterScoreMin 0
outFilterScoreMinOverLread 0.66
outFilterMatchNmin 0
outFilterMatchNminOverLread 0.66
outFilterMismatchNmax 10
outFilterMismatchNoverLmax 0.3
outFilterMismatchNoverReadLmax 1
outFilterIntronMotifs None
outFilterIntronStrands RemoveInconsistentStrands
clip5pNbases 0
clip3pNbases 0
clip3pAfterAdapterNbases 0
clip3pAdapterSeq -
clip3pAdapterMMp 0.1
winBinNbits 16
winAnchorDistNbins 9
winFlankNbins 4
winAnchorMultimapNmax 50
winReadCoverageRelativeMin 0.5
winReadCoverageBasesMin 0
scoreGap 0
scoreGapNoncan -8
scoreGapGCAG -4
scoreGapATAC -8
scoreStitchSJshift 1
scoreGenomicLengthLog2scale -0.25
scoreDelBase -2
scoreDelOpen -2
scoreInsOpen -2
scoreInsBase -2
seedSearchLmax 0
seedSearchStartLmax 50
seedSearchStartLmaxOverLread 1
seedPerReadNmax 1000
seedPerWindowNmax 50
seedNoneLociPerWindow 10
seedMultimapNmax 10000
seedSplitMin 12
alignIntronMin 21
alignIntronMax 0
alignMatesGapMax 0
alignTranscriptsPerReadNmax 10000
alignSJoverhangMin 5
alignSJDBoverhangMin 3
alignSJstitchMismatchNmax 0 -1 0 0
alignSplicedMateMapLmin 0
alignSplicedMateMapLminOverLmate 0.66
alignWindowsPerReadNmax 10000
alignTranscriptsPerWindowNmax 100
alignEndsType Local
alignSoftClipAtReferenceEnds Yes
alignEndsProtrude 0 ConcordantPair
alignInsertionFlush None
peOverlapNbasesMin 0
peOverlapMMp 0.01
chimSegmentMin 0
chimScoreMin 0
chimScoreDropMax 20
chimScoreSeparation 10
chimScoreJunctionNonGTAG -1
chimMainSegmentMultNmax 10
chimJunctionOverhangMin 20
chimOutType Junctions
chimFilter banGenomicN
chimSegmentReadGapMax 0
chimMultimapNmax 0
chimMultimapScoreRange 1
chimNonchimScoreDropMin 20
chimOutJunctionFormat 0
sjdbFileChrStartEnd -
sjdbGTFfile -
sjdbGTFchrPrefix -
sjdbGTFfeatureExon exon
sjdbGTFtagExonParentTranscript transcript_id
sjdbGTFtagExonParentGene gene_id
sjdbOverhang 100
sjdbScore 2
sjdbInsertSave Basic
varVCFfile -
waspOutputMode None
quantMode -
quantTranscriptomeBAMcompression 1
quantTranscriptomeBan IndelSoftclipSingleend
twopass1readsN 18446744073709551615
twopassMode None
----------------------------------------
Finished loading and checking parametersMy fastq file looks good so I'm not sure what it could be:
bash-4.1$ head -n 8 dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq
@HJGKNBGX5:1:11101:10000:10496
AGACAAGACAAGACCGACGTCTCTAATGTCATAGATAAAGAAGCTAATCTCTTTGATATT
+
AA///EAEE/</EA//<E<A<//E/E//E/<<//A/AAE/<E/A/A<A//A/////E/A<
@HJGKNBGX5:1:11101:10000:10980
GTACTCTGCGTTGATACCACTGCTTCCGCGGACAGGCGTGTAGATCTCGGTGGTCGCCGT
+
A///6//A<</AA////A//E6E<</</A/////<AAAE////////A//AA//</A/</
bash-4.1$ tail -n 8 dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq
@HJGKNBGX5:1:11101:10953:10799
GCTTAGTACTCTGCGTTGATACCACTGCTTAGTACTCTGCGATGATACCACTGCTTAGTC
+
AA<AAAEEAAEEEE<E/A<EAEEEEEEAEA//A/<<E<<AA/A//<E///AE<AAE//E/
@HJGKNBGX5:1:11101:10953:11536
AGAGTACGTAGTGCAGTGGATCCGCCGGTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
+
AA//AEEAAE/EEAEAEEEAEEE/EEEAE/AAE<EEAEEEAAEEEAEEAAAAEEEEEEE/
Alexander Dobin
Jan 24, 2019, 5:59:08 PM1/24/19
to rna-star
Hi Josh,
there is no error message in the Log.out file, so I am not sure what the problem could be.
Could you run the STAR command separately, i.e.:
STAR --runThreadN 1 --genomeDir /usr/local/projdata/0568/projects/PLANKTON/illumina_aallen/jmccrow/Drop-seq_Lisa/STAR --readFilesIn dropseq_output/testing/unaligned_mc_tagged_polyA_filtered.fastq --outFileNamePrefix dropseq_output/testing/star_
and capture the system error if any.
Cheers
Alex
Reply all
Reply to author
Forward
0 new messages