@A00187:37:HFM7VDMXX:1:1101:1723:1000 1:N:0:TCAGCCGT
TTCGGTCAGCTAACAATACATCCTTG
+
FFF:FFFFFFFFFFFF:FFFFFFF:F
@A00187:37:HFM7VDMXX:1:1101:1958:1000 1:N:0:TCAGCCGT
GACGTGCGTGAGGGTTCCATAGGTCC
+
FFFFFFFFFFFFFFFFFFFFFFFFFF
@A00187:37:HFM7VDMXX:1:1101:2446:1000 1:N:0:TCAGCCGT
TTGACTTAGAGTCTGGACTACAGTTC
+
FFFFFFFFFFFFFFFFFFFFFFFFFF
Any suggestion can help here.
Thanks!
Miri.
Aug 28 12:32:14 ..... started STAR run
Aug 28 12:32:14 ..... loading genome
Aug 28 12:32:42 ..... started 1st pass mapping
Segmentation fault (core dumped)STAR \
--runMode alignReads \
--runThreadN 19 \
--genomeDir /home/tgenref/homo_sapiens/grch38_hg38/hg38tgen/gene_model/ensembl_v97/tool_resources/star_2.7.1a/100bpReads \
--genomeLoad NoSharedMemory \
--twopassMode Basic \
--sjdbOverhang 99 \
--readFilesType Fastx \
--readFilesIn \
MC1685_0003_3_PB_MNC_C1_X5SCR_F01501_G3C84_AACCCGTT_L001_R2_001.fastq.gz \
MC1685_0003_3_PB_MNC_C1_X5SCR_F01501_G3C84_AACCCGTT_L001_R1_001.fastq.gz \
--readFilesCommand zcat \
--outFileNamePrefix MC1685_0003_3_PB_MNC_C1_X5SCR_ \
--outSAMtype BAM SortedByCoordinate \
--outSAMmode Full \
--outSAMunmapped None \
--outSAMmapqUnique 255 \
--outSAMattributes NH HI AS nM CR CY UR UY \
--soloType Droplet \
--soloCBwhitelist /packages/cellranger/3.0.2/cellranger-cs/3.0.2/lib/python/cellranger/barcodes/737K-august-2016.txt \
--soloFeatures Gene SJ GeneFull \
--soloUMIdedup 1MM_All \
--soloCBstart 1 \
--soloCBlen 16 \
--soloUMIstart 17 \
--soloUMIlen 10 \
--soloBarcodeReadLength 0 \
--soloStrand Reverse \
--soloOutFileNames Solo.out/ MC1685_0003_3_PB_MNC_C1_X5SCR_genes.tsv MC1685_0003_3_PB_MNC_C1_X5SCR_barcodes.tsv MC1685_0003_3_PB_MNC_C1_X5SCR_matrix.mtx MC1685_0003_3_PB_MNC_C1_X5SCR_matrixSJ.mtx MC1685_0003_3_PB_MNC_C1_X5SCR_matrixGeneFull.mtx
This electronic message is intended to be for the use only of the named recipient, and may contain information that is confidential or privileged, including patient health information. If you are not the intended recipient, you are hereby notified that any disclosure, copying, distribution or use of the contents of this message is strictly prohibited. If you have received this message in error or are not the named recipient, please notify us immediately by contacting the sender at the electronic mail address noted above, and delete and destroy all copies of this message. Thank you.