Google Groups no longer supports new Usenet posts or subscriptions. Historical content remains viewable.
Dismiss

What movie had "we don't need no stinkin' badges"?

4,836 views
Skip to first unread message

Don Brabston

unread,
Mar 16, 1995, 11:31:36 PM3/16/95
to
A friend wants to know: What was the original movie which had the quote
"badges... we don't need no stinkin' badges!"? The quote appeared in
Blazing Saddles, but apparently Saddles was using a quote from an earlier
movie. What was it, and who said it?
Thanks in advance,
Don Brabston

Gerald D. Wright

unread,
Mar 17, 1995, 1:33:15 AM3/17/95
to
Don Brabston (brab...@netcom.com) wrote:
: A friend wants to know: What was the original movie which had the quote

: "badges... we don't need no stinkin' badges!"? The quote appeared in
: Blazing Saddles, but apparently Saddles was using a quote from an earlier

The Treasure of the Sierra Madre.

Tom McPharlin

unread,
Mar 17, 1995, 4:47:09 PM3/17/95
to
In <brabston-160...@192.0.2.1> brab...@netcom.com (Don
Brabston) writes:

Treasure of the Sierra Madre, with Bogart and Walter Huston. John
Huston directed. A great great great movie. Go see it. Now.

sean

Christopher James Weber

unread,
Mar 17, 1995, 5:56:30 PM3/17/95
to
Gerald D. Wright (gdwr...@netcom.com) wrote:

or he could mean:
"We don't need no stinkin' badgers."

raul hernandez said it in the classic UHF.

if it was badges then it was the treasure of...

--
Thanks from Chris.
"Do it with style or don't bother doing it."
-Jazz the kewlest Transformer, except for Mirage

umwe...@cc.umanitoba.ca

steven_stuart

unread,
Mar 18, 1995, 10:54:26 AM3/18/95
to
In message <brabston-160...@192.0.2.1> - brab...@netcom.com (Don Bra
the movie is "treasure of the sierra madre", starring humphrey bogart. its a
great movie, watch it sometime.

Gian A. Vitzthum

unread,
Mar 19, 1995, 7:20:11 AM3/19/95
to
In a previous posting, (Steven Stuart) writes:
> In message <brabston-160...@192.0.2.1> - brab...@netcom.com (Don Bra
> bston) writes:
> the movie is "treasure of the sierra madre", starring humphrey bogart. its a
> great movie, watch it sometime.
>

While not a movie, and in obvious reference to _Treasure..._ who can
forget Dr. Johnny Fever in "WKRP in Cincinnati" relating his story of
being detained for drug possession in Mexico and the arresting police officer
asking: "Badges?!? We don't need no stinkin' badges!"
--
Gian A. Vitzthum. -- "My doctor says that I have a malformed public-duty
gland and a natural deficiency in moral fibre, and that I am therefore
excused from saving Universes." - Ford Prefect
_Life, the Universe and Everything_, Douglas Adams.

John R. Swaney

unread,
Mar 19, 1995, 2:34:58 PM3/19/95
to
In <D5osx...@freenet.carleton.ca> bn...@FreeNet.Carleton.CA (Gian A.
Vitzthum) writes:

>
>In a previous posting, (Steven Stuart) writes:
>> In message <brabston-160...@192.0.2.1> - brab...@netcom.com
(Don Bra
>> bston) writes:
>>>A friend wants to know: What was the original movie which had the quote
>>>"badges... we don't need no stinkin' badges!"? The quote appeared in
>>>Blazing Saddles, but apparently Saddles was using a quote from an earlier
>>>movie. What was it, and who said it?
>>>Thanks in advance,
>>>Don Brabston
>> the movie is "treasure of the sierra madre", starring humphrey bogart.
its a
>> great movie, watch it sometime.
>>

Here's the whole dialogue sequence. The bandito in the yellow hat
is played by Alfonso Bedoya, who (legend has it) was an actual Mexican
bandit that John Huston found somewhere. Bogart, of course, is Fred C.
Dobbs. The bandit is trying to lure Bogart and the others into giving up
their guns by pretending he (the bandit) and his men are Federal police:

Bandit: Oya, senor! We are the Federales...you know, the mounted
police.
Dobbs: If you're the police, show us your badges!
Bandit: Badges? We don't need no badges. (Angry, now...) We
don't got to show you no stinking badges!

John Swaney
Los Angeles

Ian A. Martin

unread,
Mar 19, 1995, 3:04:07 PM3/19/95
to
I seem to remember seeing a movie on T.V. that had the line: "Badgers?
We don't need no stinking badgers!" Obviously a set-up designed just to
use that line. Unfortunately, I don't remember what the movie was, nor
the set-up. Was it _Blazing_Saddles_? Help?

--
The Ropiest Guy on the 'Net

**************************************************************
* Ian Alexander Martin * ro...@freenet.vancouver.bc.ca *
**************************************************************
* Those without dreams will sleep forever *
**************************************************************

gentry, jason

unread,
Mar 19, 1995, 12:57:40 PM3/19/95
to
In <1995Mar18.1...@lmpsbbs.comm.mot.com> Steven writes:


It was said by Alphonso Bedoya playing the villainous Gold Hat.
>

Reinhold van Buren

unread,
Mar 19, 1995, 6:21:09 PM3/19/95
to
>I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>We don't need no stinking badgers!" Obviously a set-up designed just to
>use that line. Unfortunately, I don't remember what the movie was, nor
>the set-up. Was it _Blazing_Saddles_? Help?

It was "UHF" with Weird Al Yankovic. I think Cheech Marin said the badgers
line. He was doing some kind of a "Wild Kingdom" show out of his apartment
(teaching poodles to fly, sticking turtles on the ceiling), and some guy
showed up and tried to deliver a bunch of badgers.

FO...@sscl.uwo.ca

unread,
Mar 20, 1995, 12:27:55 AM3/20/95
to
In article <dlowe.43...@teleport.com> dl...@teleport.com (Reinhold van Buren) writes:
>From: dl...@teleport.com (Reinhold van Buren)
>Subject: Re: What movie had "we don't need no stinkin' badges"?
>Date: Sun, 19 Mar 1995 15:21:09 UNDEFINED

If the line is "we don't need no stinkin' badges", not "we don't need no
stinkin' badgers", then the original is of course from the classic film "
Treasure of the Sierra Madre", starring Humphrey Bogart. If it's the latter
line, I would agree that "UHF" is correct.

Brian

Vincent Paquin

unread,
Mar 21, 1995, 1:36:14 AM3/21/95
to

Yes it was in "Blazing Saddles" too.
--
Vincent Paquin, a.k.a. "The Vinman"
Anthropology student, Universite de Montreal
E-mail: vpa...@cam.org GEnie: V.PAQUIN Fax: (514) 491-7133
TAGCTCGCTAAGAGCTGTAGTCTAAAATTATATTCGGCGCTAGCTAGCAGCTGCATAGCATGCATCCGAT

John Andres

unread,
Mar 21, 1995, 2:53:31 PM3/21/95
to
vpa...@CAM.ORG (Vincent Paquin) writes:


The line "Badges! We don't need no stinking badges" was originally from
Blazing saddles. All the bad guys were lining up and signing up to go
destroy the town where the black sheriff was. Then Weird Al Yankovic
did a spoof on the line in his movie "UHF" when they used the line, "Badgers? We don't need no stinking
badgers!" Rauol, from Rauol's Wild Kingdom (a show on U-62) was
receiving a shipment of critters for his show when he saw that badgers
were on the invoice.

Hope that helps,
John

Lars Jorgen Aas

unread,
Mar 21, 1995, 6:23:36 PM3/21/95
to
Vincent Paquin <vpa...@CAM.ORG> wrote:
> Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
> > I seem to remember seeing a movie on T.V. that had the line: "Badgers?
> > We don't need no stinking badgers!" Obviously a set-up designed just to
> > use that line. Unfortunately, I don't remember what the movie was, nor
> > the set-up. Was it _Blazing_Saddles_? Help?

> Yes it was in "Blazing Saddles" too.

No, I think that was the "BADGES"-version, not the "BADGERS" version.
...but I haven't seen Blazing Saddles, I just maintained the quotes list...

Lars J

Pat Fisher

unread,
Mar 22, 1995, 11:58:26 AM3/22/95
to
Besides Treasure of the Sierra Madre, don't forget the movie UHF:
A guy gets a shipment of animals for his animal show that he does
out of his apartment. The guy dropping them off gives the show host (a
Hispanic) a list of the animals brought by. When he hear 'badgers' he
gets offensive and says "badgers? Badgers? We don't need no stinkin'
badgers!"
Pat-
y

Ebola Meinschafft

unread,
Mar 22, 1995, 2:36:51 PM3/22/95
to
"Treasure of the Sierra Madre"

BTW, the original line is "Badges? I don't have to show you any stinking
badges!" (note correct grammar)
_______________________________
Ebola Meinschafft
wa...@neb.com
/|/| "I'll write, ma," he kept saying.
/ | | "Write by WASTE," she said, "remember.
_____________/ | | The government will open it if you use
/ \ \ | | the other. The dolphins will be mad."
| | \ | | "I love you, ma," he said.
\__/ \|\| "Love the dolphins," she advised him.
"Write by WASTE."
We Await Silent -Thomas Pynchon, "The Crying of Lot 49"
Tristero's Empire

The Bomb

unread,
Mar 23, 1995, 2:16:43 PM3/23/95
to

>In <1995Mar18.1...@lmpsbbs.comm.mot.com> Steven writes:

Isn't the quote wrong, though?

I thought it went something like,

"Badges...We ain't got no badges...We don't need to show you no stinkin'
badges!"

Anyone know the exact quote?

________
The Bomb

Jeffrey Keezel

unread,
Mar 23, 1995, 5:59:36 PM3/23/95
to
While it originated in "Treasure of the Sierra Madre," (a
terrific film!!) wasn't the "Stinking badges..." line used in a
Killer Bees sketch on the old SNL as well? And was it in "Three
Amigos?"

thekeez
--
jke...@leo.vsla.edu
Media Producer at Union Theological Seminary in Virginia
Richmond, Virginia

Dean M Messing

unread,
Mar 28, 1995, 11:13:58 AM3/28/95
to
In article <3knn5o$j...@astfgl.idb.hist.no>, la...@stud.idb.hist.no (Lars
Jorgen Aas) wrote:

The line "We don't need no stinkin' badges" is paraphrased from the
original in the Bogart classic "The Treasure of the Sierra Madre". The
actor who said the line was named Fernando Bedoya. I don't remember the
exact original quote, but there were three consecutive phrases about badges
and the closest one was "We don't have to show you no stinking badges."

The "badgers" line was in the movie "UHF" with Wierd Al Yankovic and
Michael Richards (Kramer on TV's Seinfeld), who stole the show.

Dean M

George Nassiopoulos P-353 495-7181

unread,
Mar 28, 1995, 12:18:44 PM3/28/95
to
Lars Jorgen Aas (la...@stud.idb.hist.no) wrote:

"UHF" had the badgers version...

George Nassiopoulos
nas...@cfa.harvard.edu

Brett A Fishwild

unread,
Mar 28, 1995, 2:01:49 PM3/28/95
to
In <3l98od$c...@dartvax.dartmouth.edu> eme...@dartmouth.edu (The Emerald Dragon) writes:

>Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>> We don't need no stinking badgers!" Obviously a set-up designed just to
>> use that line. Unfortunately, I don't remember what the movie was, nor
>> the set-up. Was it _Blazing_Saddles_? Help?

>_UHF_, the Wierd Al Yankovic movie that featured Stanley Spudowski's
>Funhouse, Raoul's Wild Kingdom ("today, we gon' teach poodles to fly!"
>and source of the badgers line), Wheel of Fish ("and you get...
>NOTHING! STUPID!!!"), and commercials for Spatula City and _Ghandi
>II_.
>pretty lame movie overall, but the parodies were really funny...

>I believe the original quote was from _Treasure of the Sierra Madre_...
>--


> Yes, this quote IS from the old Humphrey Bogart movie titled


"Treasure of the Sierra Madre".

--
Brett A Fishwild
bf...@iastate.edu

Elena Torres

unread,
Mar 28, 1995, 12:45:41 AM3/28/95
to
As far as I know, the origin of the line is from the end of "Treasure of
Sierra Madre". A great, classic, vicious movie. Should be seen.

Maria
el...@pipeline.com

Tardis

unread,
Mar 29, 1995, 3:00:00 AM3/29/95
to
In article <bfish.7...@las1.iastate.edu>, bf...@iastate.edu (Brett A
Fishwild) wrote:

> In <3l98od$c...@dartvax.dartmouth.edu> eme...@dartmouth.edu (The Emerald
Dragon) writes:
>
> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
> >> We don't need no stinking badgers!" Obviously a set-up designed just to
> >> use that line. Unfortunately, I don't remember what the movie was, nor
> >> the set-up. Was it _Blazing_Saddles_? Help?
>

>

> >I believe the original quote was from _Treasure of the Sierra Madre_...
> >--
>
>


It may have originally been in Treasure...(I don't know, I've never seen
it), but it WAS in Blazing Saddles.

RG

+-----------------------------------------------------------------+
| Nothing ventured, Nothing Gained... |
| |
| rgav...@oeb.harvard.edu |
+-----------------------------------------------------------------+

The Emerald Dragon

unread,
Mar 28, 1995, 10:07:57 AM3/28/95
to
Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
> We don't need no stinking badgers!" Obviously a set-up designed just to
> use that line. Unfortunately, I don't remember what the movie was, nor
> the set-up. Was it _Blazing_Saddles_? Help?

_UHF_, the Wierd Al Yankovic movie that featured Stanley Spudowski's


Funhouse, Raoul's Wild Kingdom ("today, we gon' teach poodles to fly!"
and source of the badgers line), Wheel of Fish ("and you get...
NOTHING! STUPID!!!"), and commercials for Spatula City and _Ghandi
II_.
pretty lame movie overall, but the parodies were really funny...

I believe the original quote was from _Treasure of the Sierra Madre_...
--
raising the .dead, IT'S...
/-----------------------------------------------------------------\
| t h e eme...@dartmouth.edu |
| e m e r a l d /\ eme...@coos.dartmouth.edu |
| /vvvvvvvvvvvvvvvvv \---------------------------------------; |
| `^^^^^^^^^^^^^^^^^ /======================================' |
| d r a g o n \/ http://mmm.dartmouth.edu/pages/emerald/ |
\_________________________________________________________________/

Steve Quan

unread,
Mar 29, 1995, 10:26:02 PM3/29/95
to
In <rgavelis-290...@128.103.108.30> rgav...@oeb.harvard.edu
(Tardis) writes:

>
>In article <bfish.7...@las1.iastate.edu>, bf...@iastate.edu (Brett
A
>Fishwild) wrote:
>

>> In <3l98od$c...@dartvax.dartmouth.edu> eme...@dartmouth.edu (The
Emerald
>Dragon) writes:
>>
>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>> >> I seem to remember seeing a movie on T.V. that had the line:
"Badgers?
>> >> We don't need no stinking badgers!" Obviously a set-up designed
just to
>> >> use that line. Unfortunately, I don't remember what the movie
was, nor
>> >> the set-up. Was it _Blazing_Saddles_? Help?
>>
>
>>

>> >I believe the original quote was from _Treasure of the Sierra
Madre_...
>> >--
>>
>>
>
>

>It may have originally been in Treasure...(I don't know, I've never
seen
>it), but it WAS in Blazing Saddles.
>
>RG
>
>+-----------------------------------------------------------------+
>| Nothing ventured, Nothing Gained... |
>| |
>| rgav...@oeb.harvard.edu |
>+-----------------------------------------------------------------+
>

Yes, originally used in Treasure of Sierra Madre (see it at once! You
don't know what you've missed). Also used in a set up- badgers instead
of badges - on a short lived TV sitcom called Wizards and Warriors(or
something like that
-Mo

Don Brabston

unread,
Mar 31, 1995, 3:00:00 AM3/31/95
to
In article <dmmess-28...@137.35.191.103>,

dmm...@ccmail.monsanto.com (Dean M Messing) wrote:

> The line "We don't need no stinkin' badges" is paraphrased from the
> original in the Bogart classic "The Treasure of the Sierra Madre". The
> actor who said the line was named Fernando Bedoya. I don't remember the
> exact original quote, but there were three consecutive phrases about badges
> and the closest one was "We don't have to show you no stinking badges."

I posted the original request about the quote "we don't need no stinkin'
badges". I received a reply the next day that Treasure of the Sierra
Madre was the original movie with that (approximate) quote. My friend,
who asked the question of me, immediately went out and bought the movie
(on video disk, no less) and confirms the replies, of which I quote one
above. Thanks to all for their replies.

Don Brabston

Mike Cohen

unread,
Mar 31, 1995, 3:00:00 AM3/31/95
to
In article <D5osx...@freenet.carleton.ca> bn...@FreeNet.Carleton.CA (Gian A. Vitzthum) writes:
>From: bn...@FreeNet.Carleton.CA (Gian A. Vitzthum)

>Subject: Re: What movie had "we don't need no stinkin' badges"?
>Date: Sun, 19 Mar 1995 12:20:11 GMT

>In a previous posting, (Steven Stuart) writes:
>> In message <brabston-160...@192.0.2.1> - brab...@netcom.com (Don Bra
>> bston) writes:
>>>A friend wants to know: What was the original movie which had the quote
>>>"badges... we don't need no stinkin' badges!"? The quote appeared in
>>>Blazing Saddles, but apparently Saddles was using a quote from an earlier
>>>movie. What was it, and who said it?
>>>Thanks in advance,
>>>Don Brabston
>> the movie is "treasure of the sierra madre", starring humphrey bogart. its a
>> great movie, watch it sometime.
>>

Actually, the character who spoke that line in "The Treasure of Sierra Madre"
was a mexican bandito in a scene with Humphrey Bogart et al, and he never
actually said "we don't need no stinkin' badges". Bogart is trying to bluff
his way out of a potentially dangerous situation with a gang of banditos and
asks to see the banditos' badges (the banditos claim that their law officers
or some such thing). "Badges?" replies the lead bandito, "we don't got no
badges." He laughs derisively, then says either "You don't need to see no
stinking badges" or "We don't need to show you no stinkin' badges." It was
something along those lines.

A superb movie.

Mike

Jeffrey M. Zaben

unread,
Mar 31, 1995, 3:00:00 AM3/31/95
to
On 28 Mar 1995, Brett A Fishwild wrote:

> In <3l98od$c...@dartvax.dartmouth.edu> eme...@dartmouth.edu (The Emerald Dragon) writes:
>
> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
> >> We don't need no stinking badgers!" Obviously a set-up designed just to

I thought the quote was "Badges? We don't need no stinking badges!"
and was said in the movie "Troop Beverly Hills"`by maid in the scene
where they had to give up the badges to the central office.....


Dark Penguin

unread,
Mar 31, 1995, 3:00:00 AM3/31/95
to
In article <rgavelis-290...@128.103.108.30>,
rgav...@oeb.harvard.edu (Tardis) wrote:

>It may have originally been in Treasure...(I don't know, I've never seen
>it), but it WAS in Blazing Saddles.

Even though it traces back to Treasure of the Sierra Madre, the original
quote is somewhat different. Which is why I tend to consider Blazing
Saddles the "true" source since almost everyone who quotes this line seems
to be quoting the line as it was referred to in the latter film. My, what
a maverick cineaste I am! Ye cats.

Regards,

Bryan Byun e-mail: bb...@oz.net
--
"I have known what it was like to be hungry, but I always went right to a restaurant."
­ Ring Lardner, Jr.

SINEQUAN0N

unread,
Apr 2, 1995, 4:00:00 AM4/2/95
to
>
> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
> >> I seem to remember seeing a movie on T.V. that had the line:
"Badgers?
> >> We don't need no stinking badgers!" Obviously a set-up designed just
to

: I thought the quote was "Badges? We don't need no stinking badges!"
:and was said in the movie "Troop Beverly Hills"`by maid in the scene
:where they had to give up the badges to the central office.....


Ummmmm....Try Luis Valdez' play and film "Zoot Suit"...
Nancy Brown
SineTAG Solutions
Macintosh Solutions Providers
email: sin...@earthlink.net

shaun salter

unread,
Apr 2, 1995, 4:00:00 AM4/2/95
to
There was a film with "Weird Al" Yankovich (sp?) as a no-goodnick who inherited a TV (or radio?) station. The "Badgers? We
Don' need no stinkin' Badgers.." line was given by the Mexican he hired as a presenter on a pet care programme!.
I don't recall the name of the film but the pet show presenter was the same fellow who play "Jesus" (Heysus) the gang leader
in "Hill Street Blues". Hope this helps.
--
Shaun Kieran Salter
_______________________________________________________________

London, England
Reply to : sh...@heavyd.demon.co.uk
_______________________________________________________________


student

unread,
Apr 6, 1995, 3:00:00 AM4/6/95
to
In article <Pine.SUN.3.91.950331190725.10408I-100000@verdi>, "Jeffrey M. Zaben" <jza...@nmsu.edu> says:
>
>On 28 Mar 1995, Brett A Fishwild wrote:
>
>> In <3l98od$c...@dartvax.dartmouth.edu> eme...@dartmouth.edu (The Emerald Dragon) writes:
>>
>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>> >> We don't need no stinking badgers!" Obviously a set-up designed just to
>

It was a line from "Blazing Saddles " , perhaps the funniest movie ever made.

Nicholas Mcleod

unread,
Apr 6, 1995, 3:00:00 AM4/6/95
to
>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>> >> We don't need no stinking badgers!" Obviously a set-up designed just to

> I thought the quote was "Badges? We don't need no stinking badges!"

>and was said in the movie "Troop Beverly Hills"`by maid in the scene
>where they had to give up the badges to the central office.....

The movie with the "Badgers? We don't need no stinkin' badgers!" was
U.H.F. with Weird Al Yankovich (sp?). A pretty funny moment, even if you
don't know where the orginal quote comes from.

My dad told me a long time ago that he heard the line in a movie called
_The Treasure of the Sierra Madre_ or something similar.

Since I heard that line first in U.H.F., I've heard the line in about
four other movies. I can't remember what they were. I think one had
Dennis Hopper and was about a guy arrested by a young cop or fed or something
maybe played by... Dennis Quaid?... for something he did in the seventies.
Or something.

Someone help me out here!

- Nick McLeod
(n_mc...@bruny.cc.utas.edu.au)

Stephen Dedman

unread,
Apr 6, 1995, 3:00:00 AM4/6/95
to
In <3lvs7i$o...@franklin.cc.utas.edu.au> n_mc...@bruny.cc.utas.edu.au (Nicholas Mcleod) writes:

>>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>>> >> We don't need no stinking badgers!" Obviously a set-up designed just to

>> I thought the quote was "Badges? We don't need no stinking badges!"

>>and was said in the movie "Troop Beverly Hills"`by maid in the scene
>>where they had to give up the badges to the central office.....

>The movie with the "Badgers? We don't need no stinkin' badgers!" was
>U.H.F. with Weird Al Yankovich (sp?). A pretty funny moment, even if you
>don't know where the orginal quote comes from.

>My dad told me a long time ago that he heard the line in a movie called
>_The Treasure of the Sierra Madre_ or something similar.

Correct. Starred Humphrey Bogart as Fred C. Dobbs, directed by and
co-starred John Huston.

>Since I heard that line first in U.H.F., I've heard the line in about
>four other movies. I can't remember what they were. I think one had
>Dennis Hopper and was about a guy arrested by a young cop or fed or something
>maybe played by... Dennis Quaid?... for something he did in the seventies.

>Or something.

>Someone help me out here!

Movie was 'Flashback', young guy was Kiefer Sutherland. Great movie.

>- Nick McLeod
>(n_mc...@bruny.cc.utas.edu.au)

tjm

unread,
Apr 7, 1995, 3:00:00 AM4/7/95
to
The actual line from Treasure of Sierra Madre is:

"Badges? We don't got to show you no stinkin' badges"

BIER, LAURENCE

unread,
Apr 7, 1995, 3:00:00 AM4/7/95
to
In article <3m137b$e...@werple03.mira.net.au>, da...@werple.mira.net.au (David Graham) writes...

>n_mc...@bruny.cc.utas.edu.au (Nicholas Mcleod) writes:
>
>>>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>>>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>>>> >> We don't need no stinking badgers!" Obviously a set-up designed just to
>
>>> I thought the quote was "Badges? We don't need no stinking badges!"
>>>and was said in the movie "Troop Beverly Hills"`by maid in the scene
>>>where they had to give up the badges to the central office.....
>
>>The movie with the "Badgers? We don't need no stinkin' badgers!" was
>>U.H.F. with Weird Al Yankovich (sp?). A pretty funny moment, even if you
>>don't know where the orginal quote comes from.
>
>>My dad told me a long time ago that he heard the line in a movie called
>>_The Treasure of the Sierra Madre_ or something similar.
>
>>Since I heard that line first in U.H.F., I've heard the line in about
>>four other movies. I can't remember what they were. I think one had
>>Dennis Hopper and was about a guy arrested by a young cop or fed or something
>>maybe played by... Dennis Quaid?... for something he did in the seventies.
>>Or something.
>
>>Someone help me out here!

I believe the movie you're thinking of is _Flashback_, with Dennis Hopper and
Keifer Sutherland.

*******************************************************************************
"In this country you gotta make the money first. Then when you get the
money you get the power. Then when you get the power then you get the
woman."
*******************************************************************************

David Graham

unread,
Apr 7, 1995, 3:00:00 AM4/7/95
to
n_mc...@bruny.cc.utas.edu.au (Nicholas Mcleod) writes:

>>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>>> >> We don't need no stinking badgers!" Obviously a set-up designed just to

>> I thought the quote was "Badges? We don't need no stinking badges!"

>>and was said in the movie "Troop Beverly Hills"`by maid in the scene
>>where they had to give up the badges to the central office.....

>The movie with the "Badgers? We don't need no stinkin' badgers!" was
>U.H.F. with Weird Al Yankovich (sp?). A pretty funny moment, even if you
>don't know where the orginal quote comes from.

>My dad told me a long time ago that he heard the line in a movie called
>_The Treasure of the Sierra Madre_ or something similar.

>Since I heard that line first in U.H.F., I've heard the line in about
>four other movies. I can't remember what they were. I think one had
>Dennis Hopper and was about a guy arrested by a young cop or fed or something
>maybe played by... Dennis Quaid?... for something he did in the seventies.
>Or something.

>Someone help me out here!

Nick
Your dad was right (for once!) it was first said in the film
"Treasure of Sierra Madra" diercted by John Huston starring Humphrey Bogart
the scene is when some mexican bandits want to rob Humphrey and he asks
if they're from the sherrif he wants to see their badges to which they reply.

The other films mentioned are paying homage to a great movie by
mentioning the scene from The Treasure of Sierra Madra.

Regards from

David


cbg

unread,
Apr 8, 1995, 3:00:00 AM4/8/95
to
In article <3m3nrv$g...@nellie.musc.edu>, kur...@musc.edu (tjm) wrote:

> The actual line from Treasure of Sierra Madre is:
>
> "Badges? We don't got to show you no stinkin' badges"


Line is also found in Mel Brooks' Blazing Saddles hires the most ruthless
outlaws in the land and some banditos sign up for the task.

Paul Friedland

unread,
Apr 9, 1995, 3:00:00 AM4/9/95
to
In article <3lvs7i$o...@franklin.cc.utas.edu.au>, n_mc...@bruny.cc.utas.edu.au (Nicholas Mcleod) writes...

>>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
>>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
>>> >> We don't need no stinking badgers!" Obviously a set-up designed just to

<snip>


Ok, for the record now.

The original line is said by Akim Tamiroff in the film _The
Treasure of Sierra Madre_, directed by John Huston, based
on a book (that I don't think had the same name) by B. Traven.

Since then HUNDREDS of movies, tv shows, plays, comic books,
radio shows, comedians, and everybody else you can think of,
have used the line, sometimes in tribute, sometimes in jest,
often both, and sometimes with a twist, like the badgers
example. You will find it lots of places if you pay attention.
And now, you're in on the joke.

If you haven't seen the orignal, please rent it and see it
before continuing this thread. A lot of us will appreciate it.

I gotta go now.

Paul

Harris Internet Service Company

unread,
Apr 10, 1995, 3:00:00 AM4/10/95
to
BIER, LAURENCE (l_b...@pavo.concordia.ca) wrote:
: In article <3m137b$e...@werple03.mira.net.au>, da...@werple.mira.net.au (David Graham) writes...
: >n_mc...@bruny.cc.utas.edu.au (Nicholas Mcleod) writes:
: >
: >>>> >Ian A. Martin <ro...@freenet.vancouver.bc.ca> wrote:
: >>>> >> I seem to remember seeing a movie on T.V. that had the line: "Badgers?
: >>>> >> We don't need no stinking badgers!" Obviously a set-up designed just to
: >
: >>> I thought the quote was "Badges? We don't need no stinking badges!"
: >>>and was said in the movie "Troop Beverly Hills"`by maid in the scene
: >>>where they had to give up the badges to the central office.....
: >
: >>The movie with the "Badgers? We don't need no stinkin' badgers!" was

: >>U.H.F. with Weird Al Yankovich (sp?). A pretty funny moment, even if you
: >>don't know where the orginal quote comes from.
: >
: >>My dad told me a long time ago that he heard the line in a movie called
: >>_The Treasure of the Sierra Madre_ or something similar.
: >
: >>Since I heard that line first in U.H.F., I've heard the line in about
: >>four other movies. I can't remember what they were. I think one had
: >>Dennis Hopper and was about a guy arrested by a young cop or fed or something
: >>maybe played by... Dennis Quaid?... for something he did in the seventies.
: >>Or something.
: >
: >>Someone help me out here!

: I believe the movie you're thinking of is _Flashback_, with Dennis Hopper and
: Keifer Sutherland.

: *******************************************************************************
: "In this country you gotta make the money first. Then when you get the
: money you get the power. Then when you get the power then you get the
: woman."
: *******************************************************************************

Badger I know nothing about, but Badges was in Bogart's The Treasure of the Sierra
maderes.

Just my 2-cents.

marty

Wesley H Clark

unread,
Apr 11, 1995, 3:00:00 AM4/11/95
to
Paul Friedland (p...@alpha.sunquest.com) wrote:

: The original line is said by Akim Tamiroff in the film _The

: Treasure of Sierra Madre_, directed by John Huston, based
: on a book (that I don't think had the same name) by B. Traven.

BRUSH WITH GREATNESS: My father was once bought a drink at a bar by the
very same Akim Tamiroff. Nigel Bruce bought him a drink once, too.
(Watson in the Rathbone Sherlock Holmes films.) Dad was from Brooklyn and
had a very gregarious demeanor.

I now return you to your normal usenet traffic.

Wes Clark


David Wasser

unread,
Apr 13, 1995, 3:00:00 AM4/13/95
to
In article <3lvs7i$o...@franklin.cc.utas.edu.au> Nicholas Mcleod,

n_mc...@bruny.cc.utas.edu.au writes:
> My dad told me a long time ago that he heard the line in a movie called
> _The Treasure of the Sierra Madre_ or something similar.
>
> Since I heard that line first in U.H.F., I've heard the line in about
> four other movies. I can't remember what they were. I think one had
> Dennis Hopper and was about a guy arrested by a young cop or fed or
something
> maybe played by... Dennis Quaid?... for something he did in the
seventies.
> Or something.
>
> Someone help me out here!

Sorry, I can't remember the name of the film with Dennis Hopper (or even
if the line was said in it) but I do remember (vividly) the scene where
this line appears in _Blazing Saddles_ (by Mel Brooks) where the
character played by Harvey Korman is recruiting bad guys to destroy the
town. A group of Mexicans are next in line and upon receipt of their
official bad-guy badges the head honcho says it. Truly priceless.

Paul Friedland

unread,
Apr 13, 1995, 3:00:00 AM4/13/95
to
>Ok, for the record now.
>
>The original line is said by Akim Tamiroff in the film _The
>Treasure of Sierra Madre_, directed by John Huston, based
>on a book (that I don't think had the same name) by B. Traven.
>

Hello, again. After writing the above, I got mailed by a
certain Kerry Allman, who let me know in a gentle fashion
that actor who got this great line was Alphonso Bedoya.
I checked with my local library, and that's right. It WAS
Alphonso Bedoya. Thanks, Kerry.

I gotta go now.

Doug Sederberg

unread,
Apr 16, 1995, 3:00:00 AM4/16/95
to
In article <9APR1995...@alpha.sunquest.com>, p...@alpha.sunquest.com
(Paul Friedland) wrote:

> Ok, for the record now.
>
> The original line is said by Akim Tamiroff in the film _The
> Treasure of Sierra Madre_, directed by John Huston, based
> on a book (that I don't think had the same name) by B. Traven.

Either my memory is faulty (it's possible) or you've got the actor wrong.
Why do I have the indelible memory vestige of seeing none other than
Alphonso Bedoya delivering those famous lines?

Greg Wilson

unread,
Apr 17, 1995, 3:00:00 AM4/17/95
to
Doug Sederberg (vor...@calon.com) wrote:
: In article <9APR1995...@alpha.sunquest.com>, p...@alpha.sunquest.com
: (Paul Friedland) wrote:

Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
but don't quote me that it was Cheech, that actually said it in the movie.
Hope that helped.
--
----------------------------------------------------------------------------
Greg Wilson (sv...@dialix.oz.au)
"Tra,la,la, We're making the world safe for capitalism."
-March of the Covert Battalions, The Internationale, Billy Bragg

Andrew Shore

unread,
Apr 21, 1995, 3:00:00 AM4/21/95
to

On 17 Apr 1995, Greg Wilson wrote:

> Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
> but don't quote me that it was Cheech, that actually said it in the movie.

Great movie, but it was "We don't need no stinkin' badgers!", spoken by
the actor who played Jesus the gang leader on Hill Street Blues.

--
AS

joe

unread,
Apr 22, 1995, 3:00:00 AM4/22/95
to
In article
<Pine.SOL.3.91.950421...@welchlink.welch.jhu.edu>, Andrew
Shore <ash...@welchlink.welch.jhu.edu> wrote:

The movie was the three amigos with Chevy Chase, Martin Short, and Steve
Martin.
The line was spoken by one of El Guapo's men. El Guapo was the leader of
the gang who terrorized the villiage of Santa Poco.

Bob Reimer

unread,
Apr 22, 1995, 3:00:00 AM4/22/95
to
j...@ph01.bc.edu (joe) wrote:
>In article
><Pine.SOL.3.91.950421...@welchlink.welch.jhu.ed
u>, Andrew
>Shore <ash...@welchlink.welch.jhu.edu> wrote:
>
>>
>>
>> On 17 Apr 1995, Greg Wilson wrote:
> Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich.
>The movie was the three amigos with Chevy Chase, Martin Short,
>and Steve Martin.
>The line was spoken by one of El Guapo's men. El Guapo was the
>leader of the gang who terrorized the villiage of Santa Poco.

I'm a little late in this thread, so perhaps I'm repeating
someone else's post, but this quote was also used in Mel Brook's
Blazing Saddles. These are all references to the famous line in
John Huston's classic The Treasure of the Sierra Madre, with
Humphrey Bogart and Walter Huston. Fred C. Dobbs (Bogart) meets
up with some Mexican bandits who tell him they are lawmen. Dobbs
asks to see their badges and this is their leader's reply.

--
Bob Reimer
bre...@ix.netcom.com

"We don't know a millionth of one percent about anything."
Thomas A. Edison

Brian W. Dunn

unread,
Apr 25, 1995, 3:00:00 AM4/25/95
to
In article <Pine.SOL.3.91.950421...@welchlink.welch.jhu.edu>,

Andrew Shore <ash...@welchlink.welch.jhu.edu> wrote:
>
>
>On 17 Apr 1995, Greg Wilson wrote:
>
>> Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
>> but don't quote me that it was Cheech, that actually said it in the movie.
>
>Great movie, but it was "We don't need no stinkin' badgers!", spoken by
>the actor who played Jesus the gang leader on Hill Street Blues.
>
"Treasure of Sierra Madre" was original movie the line was in.

Graham Dale Martin

unread,
Apr 25, 1995, 3:00:00 AM4/25/95
to
>I'm a little late in this thread, so perhaps I'm repeating
>someone else's post, but this quote was also used in Mel Brook's
>Blazing Saddles. These are all references to the famous line in
>John Huston's classic The Treasure of the Sierra Madre, with
>Humphrey Bogart and Walter Huston. Fred C. Dobbs (Bogart) meets
>up with some Mexican bandits who tell him they are lawmen. Dobbs
>asks to see their badges and this is their leader's reply.

Actually, it is not the bandit leaders exact reply. What he really says is something like:
"We dont have to show you our stinking badges!"

Jayson Chan

unread,
Apr 25, 1995, 3:00:00 AM4/25/95
to
Andrew Shore (ash...@welchlink.welch.jhu.edu) wrote:


: On 17 Apr 1995, Greg Wilson wrote:

: > Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
: > but don't quote me that it was Cheech, that actually said it in the movie.

: Great movie, but it was "We don't need no stinkin' badgers!", spoken by
: the actor who played Jesus the gang leader on Hill Street Blues.

: --
: AS

The original line was from THE TREASURE OF SIERRA MADRE.. The original
line, in context, is actually funnier than the countless parodies!

--
J. Chan
yu10...@yorku.ca


dtk

unread,
Apr 26, 1995, 3:00:00 AM4/26/95
to
In article <3njr1u$n...@canopus.cc.umanitoba.ca>

umma...@cc.umanitoba.ca (Graham Dale Martin) writes:

> Actually, it is not the bandit leaders exact reply. What he really says is something like:
> "We dont have to show you our stinking badges!"

The line is "We don't got to show you no stinkin' badges"

Richard Contreras

unread,
Apr 26, 1995, 3:00:00 AM4/26/95
to
Andrew Shore (ash...@welchlink.welch.jhu.edu) wrote:


: On 17 Apr 1995, Greg Wilson wrote:

: > Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
: > but don't quote me that it was Cheech, that actually said it in the movie.

: Great movie, but it was "We don't need no stinkin' badgers!", spoken by
: the actor who played Jesus the gang leader on Hill Street Blues.

I believe the original quote is from the movie

Treasure of Sierra Madre (194? or 195? can't remember)

It stars Humphrey Bogart. They're looking for gold in the
Sierra Madre and they are found by some bandito's... when
questioned about their rights at doing what they do without
"badges" (authority), the reply with that line.

"Badges? We don' need no stinkin' badges!"

Rich
--
Rule of Defactualization:
Information deteriorates upward through bureaucracies.

AD SPINK

unread,
Apr 26, 1995, 3:00:00 AM4/26/95
to
It's a line said by Pancho Villa the bandit chief it that helps


Ron Drake

unread,
Apr 27, 1995, 3:00:00 AM4/27/95
to

"Treasure of the Sierra Madre"...

The line is: "Badges?! We don't have any badges! We don't have to show you
ANY stinking badges!"

Ron-Bob Sez rent the movie an' check it out.

PETER_NEPOMUCENO

unread,
Apr 27, 1995, 3:00:00 AM4/27/95
to

In <3njj9t$1...@gagme.wwa.com> hag...@gagme.wwa.com writes:

> In article <Pine.SOL.3.91.950421...@welchlink.welch.jhu.edu>,


> Andrew Shore <ash...@welchlink.welch.jhu.edu> wrote:
> >
> >
> >On 17 Apr 1995, Greg Wilson wrote:
> >
> >> Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
> >> but don't quote me that it was Cheech, that actually said it in the movie.
> >
> >Great movie, but it was "We don't need no stinkin' badgers!", spoken by
> >the actor who played Jesus the gang leader on Hill Street Blues.
> >

> "Treasure of Sierra Madre" was original movie the line was in.
>
>

((((((((((((((((((((((((((((((-)))))))))))))))))))))))))))))))))

Watch _Blazing Saddles_, it's in that scene when they were recruiting bad guys.

pn

Psycho Bitch

unread,
Apr 28, 1995, 3:00:00 AM4/28/95
to
On Wed, 26 Apr 1995, Richard Contreras wrote:

> I believe the original quote is from the movie
>
> Treasure of Sierra Madre (194? or 195? can't remember)
>
> It stars Humphrey Bogart. They're looking for gold in the
> Sierra Madre and they are found by some bandito's... when
> questioned about their rights at doing what they do without
> "badges" (authority), the reply with that line.
>
> "Badges? We don' need no stinkin' badges!"
>
> Rich


Probably been mentioned already but didn't the mexican bandidos in the
queue for Hedy ("That's Hedley!!") Lamarrs gang of thugs in "Blazing
Saddles" utter that infamous line ?

"Stampeding Cattle..thats not a crime!"
"Through the Vatican?!"
"Kinky..."

PB

http://www-hons-cs.dcs.st-and.ac.uk/~acg/home.html

@@@@@@@ @@@@@@ @@@ @@@ @@@@@@@ @@@ @@@ @@@@@@
@@! @@@ !@@ @@! !@@ !@@ @@! @@@ @@! @@@
@!@@!@! !@@!! !@!@! !@! @!@!@!@! @!@ !@!
!!: !:! !!: :!! !!: !!! !!: !!!
: ::.: : .: :: :: : : : : : :. :

@@@@@@@ @@@ @@@@@@@ @@@@@@@ @@@ @@@
@@! @@@ @@! @@! !@@ @@! @@@
@!@!@!@ !!@ @!! !@! @!@!@!@!
!!: !!! !!: !!: :!! !!: !!!
:: : :: : : :: :: : : : :


Paul Friedland

unread,
Apr 28, 1995, 3:00:00 AM4/28/95
to
In article <3nlgas$h...@nellie.musc.edu>, kur...@musc.edu (dtk) writes...

>In article <3njr1u$n...@canopus.cc.umanitoba.ca>
>umma...@cc.umanitoba.ca (Graham Dale Martin) writes:
>
>> Actually, it is not the bandit leaders exact reply. What he really says is something like:
>> "We dont have to show you our stinking badges!"
>
> The line is "We don't got to show you no stinkin' badges"


ACTUALLY, the line is repeats with small differences that build.
This is from memory:


"We don't got no badges. We don't need no badges. We don't got
to show you no stinking badges."

I spoke to a librarian about this quote a couple of weeks ago,
who found the quote in a movie quote book. The book was organ-
ized by categories like assonance, exclamations, love utterances.

Where was the badges quote? In the repetition category.

Guillermo Lopez jr

unread,
Apr 29, 1995, 3:00:00 AM4/29/95
to
The name of this movie was the Treasure of Sierra Madre,starring you
guessed it Humphery "The stuff that dreams are made of"Bogart.

-
GUILLERMO LOPEZ JR LKU...@prodigy.com

chris landers

unread,
Apr 29, 1995, 3:00:00 AM4/29/95
to
Andrew Shore <ash...@welchlink.welch.jhu.edu> wrote:
>
>
>
> On 17 Apr 1995, Greg Wilson wrote:
>
> > Wasn't the quote from the Vidiot from UHF, Wierd Al Yankovich. I think,
> > but don't quote me that it was Cheech, that actually said it in the movie.
>
> Great movie, but it was "We don't need no stinkin' badgers!", spoken by
> the actor who played Jesus the gang leader on Hill Street Blues.
>
> --
> AS

It also showed up in Blazing Saddles during the deputizing of all the criminals.

Great Flick, deserves honorable mention!!!

Jeff Nebeker

unread,
May 4, 1995, 3:00:00 AM5/4/95
to
In article <3nuf3r$d...@usenetw1.news.prodigy.com>,

Guillermo Lopez jr <LKU...@prodigy.com> wrote:
>The name of this movie was the Treasure of Sierra Madre,starring you
>guessed it Humphery "The stuff that dreams are made of"Bogart.
>
>

...and then it was used again in Blazing Saddles.


0 new messages