Re: [raxml] Bad base () error

[Alexandros Stamatakis]

Hi Patricia,

Can you send me the raxml input files please? To my personal email
address if you prefer.

Alexis

On 26.11.24 00:16, Patricia Torres-Pineda wrote:
> Hi all! I am using PAUP to generate gene trees. PAUP is calling RAxML to
> produce said gene trees. I am getting the following errors (thou it
> looks to me that the last one is the one terminating the process):
>
> paup> exe run-LimiaREFERENCED1.nex
>
>
> Processing of file
> "~/Desktop/standard-RAxML-master/run-LimiaREFERENCED1.nex" begins...
>
>
> Current directory set to /Users/ptorresp/Desktop/standard-RAxML-master
>
>
> Processing of file "~/Desktop/standard-RAxML-
>
> master/Limia_RAD24_REFERENCED_112024_ct050_msl50p_noextraOutgroups_FORGENETREES.nex" begins...
>
>
> Data read in DNA format
>
>
> Data matrix has 210 taxa, 3288098 characters
>
> Valid character-state symbols: ACGT
>
> Missing data identified by 'N'
>
> Gaps identified by '-'
>
> "Equate" macros in effect:
>
>    R,r ==> {AG}
>
>    Y,y ==> {CT}
>
>    M,m ==> {AC}
>
>    K,k ==> {GT}
>
>    S,s ==> {CG}
>
>    W,w ==> {AT}
>
>    H,h ==> {ACT}
>
>    B,b ==> {CGT}
>
>    V,v ==> {ACG}
>
>    D,d ==> {AGT}
>
>
> Processing of input file
> "Limia_RAD24_REFERENCED_112024_ct050_msl50p_noextraOutgroups_FORGENETREES.nex" completed.
>
>
> rm: Limia_REFERENCED1.tre: No such file or directory
>
>
> External command starting with 'rm' terminated with error code 1
>
>
> Currently defined models:
>
>
>   Model 'default':
>
>                            Data type = nucleotide
>
>               DNA substitution types = 6
>
>                    Exchangeabilities = estimated
>
>          GTR submodel classification = unrestricted
>
>                    State frequencies = estimated
>
>       Proportion of invariable sites = none
>
>              Rates at variable sites = gamma, shape=estimated (4
> categories [mean])
>
>                 Model correspondence = GTR+G
>
>
> +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
>
> +  "By subset" analysis: 'loci' subset 'gene0' (1 of 8918)  +
>
> +++++++++++++++++++++++++++++++++++++++++++++++++++++++++++++
>
>
> Included characters = 1-282
>
>
> Some taxa have missing data for all characters, and will therefore be
> deleted for this subset.
>
>
> Taxon-deletion status changed:
>
>   39 taxa deleted
>
>   Total number of taxa now deleted = 39
>
>   Number of nondeleted taxa = 171
>
>
> RAxML search requested.
>
>
> Current model settings =
>
>                          Data type = nucleotide
>
>             DNA substitution types = 6
>
>                  Exchangeabilities = estimated
>
>        GTR submodel classification = unrestricted
>
>                  State frequencies = estimated
>
>     Proportion of invariable sites = none
>
>            Rates at variable sites = gamma, shape=estimated (4
> categories [mean])
>
>               Model correspondence = GTR+G
>
>
> Starting RAxML with command line: cd /tmp/paup.jTjemzrs && raxmlHPC -s
> /tmp/paup.jTjemzrs/paupdata.txt -m GTRGAMMAX -T 2
>
> -n paup -f d -N 1 -p 358620688
>
>
> Beginning RAxML tree search...
>
>
> | Option -T does not have any effect with the sequential or parallel MPI
> version.
>
> | It is used to specify the number of threads for the Pthreads-based
> parallelization
>
> | ERROR: Bad base () at site 119 of sequence 11
>
> | Printing error context:
>
> |
>
> | TTTCCTCAGTAACAGGCAGGTGGTTTTTAGAGTTGTAAC
>
> |
>
> | Problem reading alignment file
>
>
> External command starting with 'raxmlHPC' terminated with error code 1
>
>
> RAxML search failed, return code = 1
>
>
> Processing of input file "run-LimiaREFERENCED1.nex" terminated due to
> errors.
>
>
> I have checked for spaces in that context and I do not see anything that
> looks wrong.
> I am new into working with this kind and data and programing, so it is
> possible I am overlooking something basic, I would appreciate a lot some
> help with this!
>
> Thank you!
>
> --
> You received this message because you are subscribed to the Google
> Groups "raxml" group.
> To unsubscribe from this group and stop receiving emails from it, send
> an email to raxml+un...@googlegroups.com
> <mailto:raxml+un...@googlegroups.com>.
> To view this discussion visit
> https://groups.google.com/d/msgid/raxml/e328c1ed-8036-4505-84bd-2c75705a9572n%40googlegroups.com <https://groups.google.com/d/msgid/raxml/e328c1ed-8036-4505-84bd-2c75705a9572n%40googlegroups.com?utm_medium=email&utm_source=footer>.

--
Alexandros (Alexis) Stamatakis

ERA Chair, Institute of Computer Science, Foundation for Research and
Technology - Hellas
Research Group Leader, Heidelberg Institute for Theoretical Studies
Full Professor, Dept. of Informatics, Karlsruhe Institute of Technology

www.biocomp.gr (Crete lab)
www.exelixis-lab.org (Heidelberg lab)

[Grimm]

Hi Patricia,

one problem (most probably) is that the intermediate "paupdata.txt" has the wrong format. What was the PAUP block line to generate it? Since you used the EQUATE setting, it may be that your ambiguity codes are replaced by bracketed representations in the matrix.

If you used PAUP's "export" command than you need to make sure that your tip names do not excess 10 digits and then use the following export command line in the PAUP block.

EXPORT File=paupdata.txt Format=Phylip MSTaxa=Missing

This should generate a matrix file that can be read-in by RAxML (I guess)

Since you're called the very basic, single-threaded version of RAxML from PAUP, the -T option has to be dropped, too.

cheers, Guido