Get Rael-Science on Twitter: https://twitter.com/rael_science

| Age | Sex | ECOG performance status | Cancer type | Disease status | Treatment line of ICI administered before FMT | No. of cycles of ICI before FMT | Type of ICI before and during the FMT trial | Best response to ICI before FMT | PD-L1 status | TMB (mutations/Mb) | Microsatellite status | |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Recipient #1 | 76 | male | 1 | ESCC | metastatic | 4 | 5 | nivolumab | PD | TPS 0% CPS 1 | 12.5 | MSS |
| Recipient #2 | 50 | female | 1 | ESCC | metastatic | 3 | 4 | nivolumab | PD | TPS 0% CPS 0 | 15.6 | MSS |
| Recipient #3 | 67 | male | 1 | HCC | metastatic | 3 | 7 | nivolumab | PD | TPS 0% CPS 0 | 20.3 | MSS |
| Recipient #5 | 55 | female | 1 | ESCC | metastatic | 4 | 13 | nivolumab | PR | TPS 0% CPS 0 | 12.5 | MSS |
| Recipient #6 | 60 | male | 1 | HCC | metastatic | 2 | 12 | nivolumab | SD | TPS 0% CPS 0 | 12.5 | MSS |
| Recipient #7 | 47 | male | 1 | HCC | metastatic | 3 | 5 | nivolumab | PD | TPS 1% CPS 3 | 12.5 | MSS |
| Recipient #8 | 64 | male | 0 | HCC | metastatic | 3 | 24 | nivolumab | PR | TPS 0% CPS 0 | 15.6 | MSS |
| Recipient #9 | 67 | male | 1 | ESCC | metastatic | 4 | 5 | nivolumab | PD | TPS 1% CPS 1 | 12.5 | MSS |
| Recipient #10 | 46 | male | 1 | GC | metastatic | 5 | 21 | nivolumab | PR | TPS 30% CPS 60 | 17.2 | MSS |
| Recipient #11 | 42 | female | 1 | GC | metastatic | 3 | 10 | nivolumab | SD | TPS 0% CPS 0 | 10.9 | MSS |
| Recipient #13 | 38 | male | 1 | GC | metastatic | 3 | 5 | nivolumab | PD | TPS 30% CPS 30 | 15.6 | MSS |
| Recipient #14 | 70 | male | 1 | ESCC | metastatic | 3 | 21 | nivolumab | PR | TPS 15% CPS 15 | 28.1 | MSS |
| Recipient #15 | 64 | male | 1 | GC | metastatic | 4 | 34 | nivolumab | PR | TPS 0% CPS 5 | 20.3 | MSS |
| Age | Sex | Cancer type | Anti-PD-1 | Response to anti-PD-1 | DoR (months) | Genetic alteration | TMB (/Mb) | Microsatellite status | PD-L1 status | EBV status | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Donor #1 | 78 | male | HCC | pembrolizumab | CR | 58.7+ | ARID1A S634∗ mutation, NFE2L2 G81C mutation, MCL1 amplification, MDM4 amplification, AKT3 amplification | 9.4 | MSS | TPS 0% CPS 0 | N/A |
| Donor #2 | 66 | male | GC | nivolumab | CR | 72.7+ | ERBB2 amplification, TP53 Q192∗ mutation | 37.5 | MSS | TPS 7% CPS 7 | negative |
| Donor #3 | 63 | male | HCC | nivolumab | PR | 7.9 | no oncogenic mutation | 15.6 | MSS | TPS 0% CPS 0 | N/A |
| Donor #4 | 78 | male | ESCC | nivolumab | PR | 15.4 | FBXW7 X327_splice alteration, TP53 P223Afs∗3 mutation, MYC amplification, CDKN2A deletion, CDKN2B deletion | 10.9 | MSS | TPS 0% CPS 0 | N/A |
| Donor #5 | 62 | male | HCC | nivolumab | CR | 31.5+ | N/A (QC fail due to low tumor cellularity) | N/A | MSS | TPS 0% CPS 0 | N/A |
| Donor #6 | 69 | male | HCC | nivolumab | CR | 25.7+ | TP53 P278R mutation | 10.9 | MSS | TPS 0% CPS 0 | N/A |



| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| InVivoMAb rat IgG2a isotype control, anti-trinitrophenol (clone 2A3) | BioXCell | Cat# BE0089; RRID: AB_1107769 |
| InVivoMAb anti-mouse PD-1 (CD279) (clone RMP1-14) | BioXCell | Cat# BE0146; RRID: AB_10949053 |
| OPAL polymer HRP Ms+Rb | Akoya Biosciences | Cat# ARH1001EA; RRID: AB_2890927 |
| anti-human CD3e antibody | BioLegend | Cat# 317325; RRID: AB_11147370 |
| anti-mouse CD3e antibody | BioLegend | Cat# 100340; RRID: AB_11149115 |
| anti-mouse CD28 antibody | BioLegend | Cat# 102116; RRID: AB_11147170 |
| Human TruStain FcX (Fc Receptor Blocking) | BioLegend | Cat# 422302; RRID: AB_2818986 |
| anti-mouse CD16/CD32 (Fc Receptor Blocking) | BioLegend | Cat# 101330; RRID: AB_2561482 |
| APC/Cyanine7 anti-mouse CD45 Antibody | BioLegend | Cat# 103116; RRID: AB_312981 |
| PerCP/Cyanine5.5 anti-mouse CD3 Antibody | BioLegend | Cat# 100218; RRID: AB_1595492 |
| PE/Cyanine7 anti-mouse CD4 Antibody | BioLegend | Cat# 100422; RRID: AB_312707 |
| APC anti-mouse CD62L Antibody | BioLegend | Cat# 104412; RRID: AB_313099 |
| PE anti-mouse CD279 (PD-1) Antibody | BioLegend | Cat# 109104; RRID: AB_313421 |
| APC/Cyanine7 anti-mouse/human CD45R/B220 | BioLegend | Cat# 103224; RRID: AB_313007 |
| APC anti-mouse CD25 Antibody | BioLegend | Cat# 101910; RRID: AB_2280288 |
| PE anti-mouse IFN-γ Antibody | BioLegend | Cat# 163503; RRID: AB_2890730 |
| BV421 anti-mouse F4/80 Antibody | BD Bioscience | Cat# 565411; RRID: AB_2734779 |
| APC anti-mouse TNF-α Antibody | BioLegend | Cat# 506308; RRID: AB_315429 |
| BV510 anti-mouse CD8a Antibody | BD Bioscience | Cat# 563068; RRID: AB_2687548 |
| BV421 anti-mouse CD44 Antibody | BD Bioscience | Cat# 563970; RRID: AB_2738517 |
| APC anti-mouse NK-1.1 Antibody | BD Bioscience | Cat# 550627; RRID: AB_398463 |
| BV421 anti-mouse CD11c Antibody | BD Bioscience | Cat# 562782; RRID: AB_2737789 |
| BB700 anti-mouse CD11b Antibody | BD Bioscience | Cat# 566416; RRID: AB_2744272 |
| BV421 anti-mouse Foxp3 Antibody | BD Bioscience | Cat# 562996; RRID: AB_2737940 |
| FITC anti-mouse NKG2A/C/E Monoclonal Antibody | eBioscience | Cat# 11-5896-82; RRID: AB_465305 |
| Bacterial and virus strains | ||
| P. merdae Immunoactis | This work | KCTC14922BP |
| Bacteroides plebeius KCTC5793 | Korean Collection for Type Cultures (KCTC) | KCTC5793 |
| Lactobacillus salivarius KCTC43133 | Korean Collection for Type Cultures (KCTC) | KCTC43133 |
| Biological samples | ||
| Human feces | This study | N/A |
| Human blood samples | This study | N/A |
| Human tumor tissues | This study | N/A |
| Chemicals, peptides, and recombinant proteins | ||
| Brain heart infusion (BHI) broth | BD Biosciences | Cat# 237500 |
| Reinforced clostridial medium (RCM) broth | BD Biosciences | Cat# 218081 |
| De Man, Rogosa and Sharpe (MRS) broth | BD Biosciences | Cat# 288130 |
| Yeast extract | BD Biosciences | Cat# 212750 |
| L-Cysteine hydrochloride monohydrate | Merck | Cat# C7880 |
| Hemin | Sigma-Aldrich | Cat# H9039 |
| Vitamin K1 | Sigma-Aldrich | Cat# 95271 |
| Kanamycin | Rd-tech | Cat# HKA01 |
| Defibrinated sheep blood | KisanBio | Cat# S1876 |
| DMEM medium | ThermoFisher | Cat# 11965-118 |
| RPMI 1640 medium | Corning | Cat# 10-040-CV |
| Fetal bovine serum (FBS) | MP Biomedicals | Cat# 92916754 |
| PBS | ThermoFisher | Cat# 10010-049 |
| Penicillin-streptomycin | ThermoFisher | Cat# 15140-122 |
| NEAA (MEM Non-Essential Amino Acids Solution) | ThermoFisher | Cat# 11140-050 |
| HEPES | ThermoFisher | Cat# 15630-080 |
| Sodium pyruvate | ThermoFisher | Cat# 11360070 |
| L-glutamine | ThermoFisher | Cat# 25030-081 |
| 2-mercaptoethanol | ThermoFisher | Cat# 21985-023 |
| carboxyfluorescein diacetate succinimidyl ester (CFSE) | ThermoFisher | Cat# C34554 |
| EDTA | ThermoFisher | Cat# AM9260G |
| Ficoll® Paque Plus | Merck | Cat# GE17-1440-02 |
| RBC lysis buffer | BioLegend | Cat# 420301 |
| Ovalbumin (323-339) | Merck | Cat# O1641 |
| TRIzol reagent | Invitrogen | Cat#15596026 |
| Collagenase type I | ThermoFisher | Cat# 17100-017 |
| Collagenase type II | ThermoFisher | Cat# 17101-015 |
| Collagenase type IV | ThermoFisher | Cat# 17104-019 |
| DNase type I | Merck | Cat# 10104159001 |
| hyaluronidase type IV-S | Merck | Cat# H3884 |
| Fixation/permeabilization buffer set | BioLegend | Cat# 424401 |
| Leica Bond Dewax solution | Leica Biosystems | Cat# AR9222 |
| Bond Epitope Retrieval 1 | Leica Biosystems | Cat# AR9961 |
| Bond Epitope Retrieval 2 | Leica Biosystems | Cat# AR9640 |
| Antibody diluent/block | Akoya Biosciences | Cat# ARD1001EA |
| DAPI and Hoechst Nucleic Acid Stains | ThermoFisher | Cat# 62248 |
| ProLong Gold antifade reagent | ThermoFisher | Cat# P36935 |
| Maxpar Cell Staining Buffer | Fluidigm | Cat# 201068 |
| Cell-ID Intercalator-Ir | Fluidigm | Cat# 201192A |
| Maxpar Fix and Perm Buffer | Fluidigm | Cat# 201067 |
| Critical commercial assays | ||
| Simoa CorPlex Human Cytokine 10-plex Panel 1 kit | Quanterix | Cat# 85-0329 |
| Maxpar Direct Immune Profiling Assay kit | Fluidigm | Cat# 201334 |
| FastDNA® SPIN Kit for Soil | MP Biomedicals | Cat# 116560200-CF |
| 2× KAPA HiFi HotStart ReadyMix | Roche | Cat# 07958927001 |
| TruSeq Nano DNA sample Prep Kit, set A | Illumina | Cat# TG-202-1001 |
| TruSeq Nano DNA sample Prep Kit, set B | Illumina | Cat# TG-202-1002 |
| Human CD4+ T Cell Isolation Kit | Miltenyi Biotec | Cat# 130-096-533; RRID: AB_2916089 |
| Human CD8+ T Cell Isolation Kit | Miltenyi Biotec | Cat# 130-096-495; RRID: AB_3073903 |
| Mouse CD8+ T Cell Isolation Kit | Miltenyi Biotec | Cat# 130-104-075 |
| Human IFN-γ ELISA kit | ThermoFisher | Cat# 88-7316-88 |
| Annexin V–PI staining kit | Enzo Life Science | Cat# ALX-850-020-K101 |
| TOPscript™ RT DryMIX kit | Enzynomics | Cat# RT200 |
| TOPreal™ qPCR 2X PreMIX kit | Enzynomics | Cat# RT501M |
| Deposited data | ||
| Raw Sequencing files | This Study | ENA: PRJEB48251 |
| Experimental models: Cell lines | ||
| MC38 (mouse colon cancer cell line) | Lab stock | ENH204-FP; RRID: CVCL_B288 |
| 4T1 (mouse breast cancer cell line) | Lab stock | CRL-2539; RRID: CVCL_0125 |
| Experimental models: Organisms/strains | ||
| Female C57B6/N mice (Seven weeks-old) | Orientbio | RRID: MGI:5882838 |
| Female Balb/c mice (Seven weeks-old) | Orientbio | RRID: MGI:6323059 |
| OT-1 mice (Tg[TcraTcrb]1100Mjb/J) | In-House Breeding | RRID: IMSR_JAX:003831 |
| Oligonucleotides | ||
| TCGTCGGCAGCGTCAGATGTGTATAA GAGACAGCCTACGGGNGGCWGCAG |
This study | Forward primer for bacterial 16s rRNA V3-V4 regions |
| GTCTCGTGGGCTCGGAGATGTGTATAA GAGACAGGACTACHVGGGTATCTAATCC |
This study | Reverse primer for bacterial 16s rRNA V3-V4 regions |
| GCTCAACCTGGGCATTGCA | This study | Forward primer for identifying P. merdae Immunoactis |
| CATGTTTTAGGGATTCGAGCG | This study | Reverse primer for identifying P. merdae Immunoactis |
| Software and algorithms | ||
| GraphPad Prism 10 | GraphPad Software | https://www.graphpad.com/ |
| FlowJo v10.10.0 | Treestar, Inc. | https://www.flowjo.com/ |
| FACS Diva 9 | BD Biosciences | https://www.bdbiosciences.com/en-us/products/software/instrument-software/bd-facsdiva-software |
| Phenochart v2.2.0 | Akoya Biosciences | https://www.akoyabio.com/support/software/ |
| inForm Image Analysis software v3.0 | Akoya Biosciences | https://www.akoyabio.com/support/software/ |
| FCS Express 7 Flow software | De Novo Software | https://denovosoftware.com/ |
| phenoptrReport packages | Akoya Biosciences | https://akoyabio.github.io/phenoptrReports/index.html |
| Cutadapt version 4.1 | Martinl. | https://journal.embnet.org/index.php/embnetjournal/article/view/200 |
| QIIME2 version 2022.8 | Bolyen et al. | https://qiime2.org/ |
| DADA2 software package | Callahan et al. | https://github.com/benjjneb/dada2 |
| RESCRIPt | Robeson et al. | https://github.com/bokulich-lab/RESCRIPt |
| R (version 4.2.1) | R core team | https://www.R-project.org/ |
| ggpubr package (version 0.6.0) | Kassambara | https://rpkgs.datanovia.com/ggpubr/ |
| Analysis of Composition of Microbiomes (ANCOM) | Mandal et al. | https://qiime2.org/ |
| kneaddata (version 0.12.0) | Biobakery group | https://github.com/biobakery/kneaddata |
| HUMAnN 3 | Beghini et al. | https://github.com/biobakery/humann |
| StrainPhlAn 4 | Truong et al. | https://github.com/biobakery/biobakery/wiki/strainphlan4 |
| Jalview | Waterhouse et al. | https://www.jalview.org/ |
| FastTree (version 2.1.11) | Price et al. | http://www.microbesonline.org/fasttree/ |
| FigTree (version 1.4.4.) | Rambaut | http://tree.bio.ed.ac.uk/software/figtree/ |
| BBDuk | Bushnell. | https://github.com/BioInfoTools/BBMap |
| Unicycler(version 0.5.0) | Wick et al. | https://github.com/rrwick/Unicycler |
| Usearch (version 11.0.667) | Edgar | https://www.drive5.com/usearch/ |
| JspeciesWS | Richter et al. | https://jspecies.ribohost.com/jspeciesws/#home |
| OrthoANI | Lee et al. | https://www.ezbiocloud.net/tools/orthoani |
| Other | ||
| Anaerobic jar | Oxoid | Cat# HP0011A |
| Anaeropack | MGC | Cat# A-06 |
| GasPak 100 system | BD Biosciences | Cat# 260626 |
| Cuvette | Ratiolab | Cat# HRA-2712120 |
| 0.2 μm syringe filte | Satorius | Cat# 17823-K |
| 40 μm cell strainer | Falcon | Cat# 352340 |
| 70 μm cell strainer | Falcon | Cat# 352350 |
| 60 mm non-treated plate | SPL | Cat# 11060 |
| 96-well non-treated plates | SPL | Cat# 32096 |
| Cell counting slide | Logos biosystems | Cat# L12001 |
| Insulin syringe 0.5mL, 31G, 8mm | BD | Cat# 328821 |
| DNA/RNA Shield Fecal Collection Tube | Zymo Research | Cat# R1101 |