assign_taxonomy.py Fatal error input is not FASTA file

[Guerrino Macori]

Dear Qiime community, 

I tried the following command for the taxonomy assignment to each sequence:  

assign_taxonomy.py -i ~/FILE.fasta -r ~/ref_seq_set.fasta -t ~/97_otu_taxonomy.txt -o ~/Assign_taxonomy  

but I received the following message:  

---Fatal error--- Input is not FASTA file

I double checked the file and it's seem fine, do you have any suggestions?

Thanks for the help,

All the best

[Colin Brislawn]

Hello Guerrino,

Thanks for posting this full error.

So, is ~/FILE.fasta a fasta file? Perhaps you could post the first few lines so we can take a look at it, using this linux command:

head ~/FILE.fasta

Thanks for getting in touch,

Colin

[Guerrino Macori]

I double cheked the file, it is a fasta.

>M02817:14:000000000-ALNWN:1:1101:26288:20036

CCTACGGGTGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTT

TCGGATCGTAAAACTCTGTTGTTAAAGAAGAACAAGGATGAGAGTAACTGCTCATCCCCTGACGGTATTTAACCAGAAAG

I understood what happened:

the two files:

97_otus.fasta and ref_seq_set.fasta

were not matching.

Thanks a lot for the support!

[Colin Brislawn]

Ah, thank you for sharing how you fixed this problem.

Have a great day!

Colin