assign_taxonomy.py Fatal error input is not FASTA file

10 views
Skip to first unread message

Guerrino Macori

unread,
Mar 16, 2017, 5:00:35 AM3/16/17
to Qiime 1 Forum
Dear Qiime community, 
I tried the following command for the taxonomy assignment to each sequence:  

assign_taxonomy.py -i ~/FILE.fasta -r ~/ref_seq_set.fasta -t ~/97_otu_taxonomy.txt -o ~/Assign_taxonomy  

but I received the following message:  

---Fatal error--- Input is not FASTA file

I double checked the file and it's seem fine, do you have any suggestions?

Thanks for the help,
All the best

Colin Brislawn

unread,
Mar 16, 2017, 12:54:46 PM3/16/17
to Qiime 1 Forum
Hello Guerrino,

Thanks for posting this full error.

So, is ~/FILE.fasta a fasta file? Perhaps you could post the first few lines so we can take a look at it, using this linux command:
head ~/FILE.fasta

Thanks for getting in touch,
Colin

Guerrino Macori

unread,
Mar 17, 2017, 6:00:50 AM3/17/17
to Qiime 1 Forum
I double cheked the file, it is a fasta.

>M02817:14:000000000-ALNWN:1:1101:26288:20036

CCTACGGGTGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTT

TCGGATCGTAAAACTCTGTTGTTAAAGAAGAACAAGGATGAGAGTAACTGCTCATCCCCTGACGGTATTTAACCAGAAAG


I understood what happened:

the two files:

97_otus.fasta and ref_seq_set.fasta

were not matching.


Thanks a lot for the support!


Colin Brislawn

unread,
Mar 17, 2017, 1:13:48 PM3/17/17
to Qiime 1 Forum
Ah, thank you for sharing how you fixed this problem.

Have a great day!
Colin
Reply all
Reply to author
Forward
0 new messages