How t remove three primers using split_library.py

13 views
Skip to first unread message

monica steffi matchado

unread,
Aug 24, 2019, 2:31:25 AM8/24/19
to Qiime 1 Forum
Dear All,
I have pair-end Illumina raw reads for V1-V9 region. During sequencing, 3 primers were used as follows:
    V13F    AGAGTTTGATGMTGGCTCAG
    V13R    TTACCGCGGCMGCSGGCAC
    V46F    GTGCCAGCTGCCGCGGTAATAC
    V46R    CTGACGACAGCCATGCA
    V79F    GCAACGAGCGCAACCCC
    V79R    AAGGAGGTGATCCAGGC
How do I incorporate these primers in map.txt file and remove using split_library at once?

TonyWalters

unread,
Aug 24, 2019, 2:39:55 AM8/24/19
to Qiime 1 Forum
Hello Monica,

For the LinkerPrimerSequence and ReversePrimer fields, put in all primer variants, comma separated, with no spaces, e.g. 
AGAGTTTGATGMTGGCTCAG,GTGCCAGCTGCCGCGGTAATAC,GCAACGAGCGCAACCCC

for the LinkerPrimerSequence fields.
Reply all
Reply to author
Forward
0 new messages