Quality filter non-multiplexed samples stitched with Pandaseq: output file empty!

1,690 views
Skip to first unread message

Niccolo`

unread,
May 15, 2013, 12:21:04 PM5/15/13
to qiime...@googlegroups.com
Hi everybody,

I am trying to analyse my 16S data coming from a run of Miseq PE 2x250. I submitted 6 samples and I have received from the sequencing center 6 fastq files (12 if we consider R1 and R2), so already demultiplexed and without any barcode file.
I have used Pandaseq to stitch R1 and R2 reads together and now I would like to run split_libraries_fastq.py to do quality filtering. This is the command I used:

split_libraries_fastq.py -i stitched.fastq --sample_id Y -o split_libraries/ -m Ymapfileforsplitlibr.txt -q20 --barcode_type 'not-barcoded'

The script works but the output fasta file is empty and in the log file it is written:

Quality filter results
Total number of input sequences: 448526
Barcode not in mapping file: 0
Read too short after quality truncation: 448526
Count of N characters exceeds limit: 0
Illumina quality digit = 0: 0
Barcode errors exceed max: 0

Result summary (after quality filtering)
Median sequence length: nan
MK3    0

Total number seqs written    0

I am enclosing the FastQC screenshot of the stitched file: the qualiy drops a bit in the middle,but could that explain the problem? I tried to run split_libraries_fastq.py without -q20 but still I can keep only few reads.

Can anyone please help me to understand what is the problem?

I also read the discussion https://groups.google.com/forum/#!msg/qiime-forum/CO9EmR4FH58/vNuaaOyAv-cJ but I think my case is different since I don`t have the problem to combine the barcode file and the stitched file.

Just in case here is how the original file and the stitched files look like:

original

@M01168:27:000000000-A2Y50:1:1101:14172:1431 1:N:0:16
CTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGAGATCGTCGGCTTGGTAGGCCTTTACCCCACCAACTACCTAATCCCACTTGGGCTCATCTTATGGCATATGGTCTTGCGATCCCATACTTTAATCTTTCGATATTACGCGGTATTAGCTACAGTTTCCCGTAGTTATCCCCCTCCATAAGCCAGATTCCCAAGCATTACTCACCCGTCCGC
+
GGGGHHHGGGFHHHGHHGHHHGHHHFFHHGGHHHHHHHHHHHHHHHHHHHHHGHHHHGHHGGGGGGGGHHGHHHHHGHHHHGGGHHGHHHHHHHHHHHHHHHHHHHHHHHHHHHHHEHHHHHHHHHHHGHGGHGGHHHGHHHHHHHGHHHHGGHGGHHHAAFGFGGHHHHHHHHGHHHHHHGHGGFFGGGFFFGGGGGGGGFFBFFGGGGGFFGEGFFFFFFFFFFFDD?AB;
@M01168:27:000000000-A2Y50:1:1101:16756:1431 1:N:0:16
GATGAACGCTAGCGGCAGGCCTAAAACATGCAAGTCGAGGGGCAAGGGGCTTCGGCCTCCTAGACCGGCGTACGGGTGCGTAACGCGTGTACAATCTACCTTTTACTACTGGATATCCCGGAGAAATTTGGATTAATACGGTATAGTATTATTTATAGGCATCTATTAATAATTAAAGATTTATTGGTAAAAGATGAGTACGCGTTCTATTAGTTAGTTGGAGTGGTAACG
+
GFGHHHHHGGGGHCCGCEG?FBAG3BFGFCFHHFBFEEEGGGGEGFEFG?/1FEF?EEGEHHHD?F@EEG?@/<AC/BAD/AD<?AC>D<0FGF1>1<F1<F<GGHDDF00C/DDDGHHFGGGGHH;FHHGGBFFFBB;EG:E.FF;CFBFFGGGBFFCBCCF0;0CFGGGGFFFFFFFFBFFBFFBBFFBFBEFFB;/B9.DB--9EFFFFF/:;99;FFBB9AA9BF/.

stitched

@M01168:27:000000000-A2Y50:1:1101:14172:1431:16
ATTGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGAACGGTAGCAGGAAGTACTTGTTTTCTTGCTGACGAGTGGCGGACGGGTGAGTAATGCTTGGGAATCTGGCTTATGGAGGGGGATAACTACGGGAAACTGTAGCTAATACCGCGTAATATCGAAAGATTAAAGTATGGGATCGCAAGACCATATGCCATAAGATGAGCCAAAGTGGGATTAGGTAGTTGGTGGGGTAAAGGCCTACCAAGCCGACGATCTCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAG
+
FFFHHHHHFFF?FFCCFFFFHHFH5FFFHFHHFFFHFEAFECEEEEFEC?FF@FFHFHFHFHHHHHHFFBFFFFFH:@@>>.;AA;=.B!>B0B0CAA.ACDD0B@CBBD0CBCCC>?A>BBBCACDD>-,:?C@CDDCCCDDCCCC@?@@,9A>:8:8@CCCCCCCCCC@CCCCCC@9@B>-8A-8AAACC.:CC88ACC.88AA!A-.!-8-!!:8.9.:8.:.:8C@CHFHHHHHFHHFFFFFFFFHHFHHHHFHHHHHHHHHHHHHHHHHHHHHFFHHFFHHHFHHHFHHFHHHFFFFHHHFFFF
@M01168:27:000000000-A2Y50:1:1101:16756:1431:16
CTGGTCCGTGTCTCAGTACCAGTGGGGGGGACATCCCTCTCAGAACCCCTATCTATCATCGCCTTGGTGTGCCGTTACCACTCCAACTAACTAATAGAACGCGTACTCATCTTTTACCAATAAATCTTTAATTATTAATAGATGCCTATAAATAATACTATACCGTATTAATCCAAATTTCTCCGGGATATCCAGTAGTAAAAGGCAGATTGTACACGCGTTACGCACCCGTACGCCGGTCTAGGAGGCCGAAGCCCCTTGCCCCTCGACTTGCATGTTTTAGGCCTGCCGCTAGCGTTCATC
+
FFF/1BFFFFBFBF1ECFFFFF1B/BAACCFAFB8/ABB:CFFFFFF-9EFFFFFFFFFFFFBA,8//898F-.@,,=?8@@B,:88:9.BB@@BB8,,@=-8:.88B@@@@..:>@BB@.B@BBBB@B:@@.CC.:/:/BA?@A.::.CCBB>B.:8B-.9.@:,:BB@.@..8::CC.:.@@,8?>??,./,.::.!:;B,0,!090B.8,8?<.,97,8.?=,.,,7+,9FEE@F?CHHHEFEE?FEF1/?FFEFFEFFFFEEEFBFHHFCFFFB2FABF?FECFCCHFFFFHHHHHFFF

Thanks a lot for any help!

Niccolo`
Screenshot.png

Jose Navas

unread,
May 15, 2013, 12:37:43 PM5/15/13
to qiime...@googlegroups.com
Hi Niccolo,

Your sequences have been filtered because they are truncated by early low-quality base calls. By deafult, if the lenght of the trucanted sequences is below 75% of the full length, they are discarded. You can change this parameter by providing the -p parameter. For example, if you want to retain the sequences that their length is at least the 50% of the full length, you should provide -p 0.5:

split_libraries_fastq.py -i stitched.fastq --sample_id Y -o split_libraries/ -m Ymapfileforsplitlibr.txt -q20 --barcode_type 'not-barcoded' -p 0.5

Hope this helps!


2013/5/15 Niccolo` <niccolo...@gmail.com>


Niccolo`

--
 
---
You received this message because you are subscribed to the Google Groups "Qiime Forum" group.
To unsubscribe from this group and stop receiving emails from it, send an email to qiime-forum...@googlegroups.com.
For more options, visit https://groups.google.com/groups/opt_out.
 
 



--
Jose Navas

Tony Walters

unread,
May 15, 2013, 12:49:16 PM5/15/13
to qiime...@googlegroups.com
Hello Niccolo,

We ran into something like this before with reads being discarded due to poor quality in the middle of the reads after being stitched.  I think you will have to alter two of the parameters to allow output, by increasing -r and decreasing -p from the default values.

-Tony




Niccolo`

--

Niccolo`

unread,
May 16, 2013, 10:38:35 AM5/16/13
to qiime...@googlegroups.com
Hi Jose, Hi Tony!

thanks for your replies!
as you both suggested I tried to solve my problem changing the -r -p and -q parameters: I decreased -p until 0.1 and increased -r until 20 but still all my sequences were removed. Then I tried to decrease -q, and I was finally able to keep most of the sequences using the default (-q 3), but when I look at the histogram file most of the sequences are too short (only 70 bp)(that is the point where quality drops)!

split_libraries_fastq.py -i stitched.fastq --sample_id Y -o split_libraries/ -m Ymapfileforsplitlibr.txt --barcode_type 'not-barcoded' -p 0.1 -r 20

I am still surprised that I cannot use this file because the R1 and R2 files were not quite good in term of quality (just as usual going down at the end of the reads).

The alternative way I have been using is combining Mothur and Qiime: I run my R1 and R2 files in Mothur using the make.contigs script to stitch them, remove reads with ambiguous bases, merging duplicates sequences and removing chimeras using Uchime; then I move to Qiime for OTU picking and the following analyses. How does this approach look to you?
My main concern is that I cannot run split_libraries.py on the file I can create in this way since make.contigs in Mothur gives back only a fasta file, so I don`t have a real quality check of my sequences and I don`t know if the taxonomic assignment and the following analyses are reliable..

Do you know any way that I can use to overcome this problem? or the only other chance I have is use R1 and R2 files separately?

Any help would be really apprecited!

Thanks

Niccolo`


Brenda Koster

unread,
May 16, 2013, 11:20:49 AM5/16/13
to qiime...@googlegroups.com
Hi Niccalo

We used;
-q = default
-r = 3
-p = 0.00

As near as I can tell, setting -p to 0.00 effectively turns the -p quality filter off (perhaps another option is setting -p = 1?).  In assembled sequences, I would think that the more problematic regions are in the middle (i.e. corresponding to the end of each read where the quality gradually drops).  Since Pandaseq has a quality check for the overlap/assembled region, we are relying on 1) the -r option in this command (indeed turning off -p does result in more reads being culled by -r), and 2) the fact that we were clustering at 97% downstream to take care of a lot of the noise that might be introduced by a less stringent approach here.  We will also be interpreting any novel taxa very conservatively.

We have just started working with the assembler so we would greatly appreciate any thoughts or concerns on this approach.

Hope you find this useful
Brenda





Niccolo`


Mike

unread,
May 16, 2013, 6:12:41 PM5/16/13
to qiime...@googlegroups.com
Hi all,

I've run into this exact issue many times myself. However, I switched to using FLASH (http://ccb.jhu.edu/software/FLASH/) for my assemblies. It seems to result in better quality scores than pandaseq for the assembled data, especially the overlapping regions. I do not know why. Anyway, I can process my FLASH assembled data with -q 20 and it works fine. However, I must use -q of ~3 with pandaseq to retain the same level of data.  

If I do not have primers in my sequences I use FLASH (JGI uses this to assemble their reads). Otherwise, I am limited to using pandaseq because our Illumina data contains both the forward and reverse primer sequences within our reads and must be trimmed. The only way I can trim the forward reads is via pandaseq, unless anyone can suggest other options?  Also, FLASH outputs data in a format that is QIIME friendly. I've had to write scripts, similar to what you may have seen on the forums, to make the pandaseq output QIIME friendly.

One caveat to note here: If you read the pandaseq documentation, they claim that using the quality-scores for quality-filtering post-assembly is a misuse of the scores, but they fail to mention why. Specifically, they state: 

"-F                   Normally, output will be as a FASTA even though per-base quality information is available. To retain this quality information, this option will output the sequence and the quality information in FASTQ format with quality scores encoded as PHRED + 33 (even if the input scores are PHRED + 64). The meaning of the quality score is conceptually different from the input quality scores for the overlap region, but this may not matter depending on your downstream application. If you intend to use this information for further quality filtering, especially by a program expecting Illumina reads, you are not using this data correctly."

Located here:

So, if you do not need to trim forward primers, give FLASH a try.

-Hope this helps.
-Mike

Niccolo`

unread,
May 21, 2013, 5:41:30 AM5/21/13
to qiime...@googlegroups.com
Hi Mike,

thanks for your reply and the info regarding Pandaseq! It is really interesting what they say!

I usually use first Cutadapt to trim the primers from my reads (R1 and R2) and then try to stitch the 2 files. So you can try to use Cutadapt to not depend on Pandaseq for data containing both primers.

I tried to use FLASH instead of Pandaseq: using default parameters, the program is giving me as output an extended.frags file only with very few reads, so apparently it combines only very few reads...do you have any idea why? Do you know if there is something I have to change to make it work properly?

Thanks

Niccolo`

Mike

unread,
May 21, 2013, 9:22:55 AM5/21/13
to qiime...@googlegroups.com
Thanks for that information Niccolo. I'll give Cutadapt a try. It's been my experience, with trying all of the various assembly programs, that you need to tailor the parameters to your data. So, I used the following settings on my data (which typically had complete overlapping reads):

-r 250 -f 180 -s 10 -m 15 -M 280 - x 0.35

If I remember correctly I had assembled ~93% or more of my reads. I'd have to get back to you as I am currently at the ASM meeting. I plan on assembling a bunch of Illumina data within the next month. I should be able to provide more detail on my work flow then.

-Mike

Niccolo`

unread,
May 22, 2013, 3:44:37 AM5/22/13
to qiime...@googlegroups.com
Hi Mike

thanks for the information!
I tried with the following parameters
-r 230 -f 300 -s 30 -m 15 -M 160  (my fragment length is around 300 bp and my reads are around 230bp)
but the program gives me this message:
"Read length has to be in the range (0,170]. If the reads are longer than 170, please change the constant value for READ_LENGTH in utilities.h"
Then I changed the first line in the file utilities.h from #define READ_LENGTH 170 to #define READ_LENGTH 250
Since I can see that you also used -r above 170, could you please help me to solve this problem?

Thanks a lot

Niccolo`

Mike

unread,
May 22, 2013, 9:00:08 AM5/22/13
to qiime...@googlegroups.com
Ahh, that only results from downloading and installing the older archived versions of the software. I did the same thing in fact! :-)

The link for the most current version does not stand out very well on their page. They really need to make it more obvious. Anyway, click on the word 'sourceforge' in following line of the FLASH web page (http://ccb.jhu.edu/software/FLASH/): 

"Please download the latest version of FLASH code or executable from sourceforge."

-Mike

Niccolo`

unread,
May 22, 2013, 10:49:42 AM5/22/13
to qiime...@googlegroups.com
Hi Mike,

oh I see! I was not really able to spot the link to the latest version (but you`re right, it was not so obvious!)

With the latest version, everything was fine! :)

Thanks you very much

Cheers

Niccolo`

Mike

unread,
May 22, 2013, 6:17:06 PM5/22/13
to qiime...@googlegroups.com
Glad I could help! :-)

Can you give us some more details on how well it worked? Did enough of your data assemble? Were you able to set '-q 20' for split_libraries_fastq.py?

-Mike

Niccolo`

unread,
May 23, 2013, 5:33:42 AM5/23/13
to qiime...@googlegroups.com
Hi Mike,

so I think FLASH worked very well!

I used -m 10 (it gave me same results of -m 15) and tried different values for -x (0.05, 0.1 and 0.2, so from a very conservative approach to a less conservative one) (I decide to stay quite low with the value for this parameter, since from the comparison with other merging scripts it is usually suggested to use low values...), and I was able to merge from 79 to 93% of my reads respectively.

After that I ran my data through split_libraries_fastq.py with -q 20 and default values of -r and -p, and I was able to keep around 90% or more of my reads, keeping also the size of the fragments I am interested in.

I would say I am quite happy with these results so far...are they similar to yours?

Cheers

Niccolo`

Mike

unread,
May 24, 2013, 11:10:01 AM5/24/13
to qiime...@googlegroups.com
It's nice to see that it worked out so well! The results are similar to what I've been getting.

-Mike

saltyk

unread,
Sep 12, 2013, 1:35:21 PM9/12/13
to qiime...@googlegroups.com

I am attempting to use FLASH to assemble R1 & R2 files generated by a MiSeq.  After running FLASH, I filtered my index files to remove the reads that were eliminated by FLASH and then checked to make sure that my new stitched read and index files had the same number of sequences.  All appeared to work well until I brought the files back into QIIME and then got the following error when I ran split_libraries.py:  


qiime.split_libraries_fastq.FastqParseError: Headers of barcode and read do not match. Can't continue. Confirm that the barcode fastq and read fastq that you are passing match one another.


Sample Index file header:


@M00459:4:000000000-A191G:1:1101:13176:2189 1:N:0:7

NGATAAGC

+

#>>AAA4B

@M00459:4:000000000-A191G:1:1101:16100:2197 1:N:0:7

GGATAAGC

+

AAABAFDD



Sample assembled read header:


@M00459:4:000000000-A191G:1:1101:13176:2189 1:N:0:7

TACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAANAGCGTGTAGGCNNNTNAGTCAGTCTGGTGTGAAATCTCGGGGCTCAACCCCGAGCGGTCACTGGATACTGCTGGGCTAGAATCCGGAAGAGGGGAGTGGAATTACTGGTGTAGCGGTGGAATGCGCAGATATCAGGAGGAACACCAATGGCGAAGGCAGCTCGCTGNNNCGGTATTGACGCTGAGACGCGAAAGCGTGGGGAGCGAACAGN

+

ABBA>FFBBBBBGGGGGGGGGGHGGGGGFHGHHHHHGGGGH#1BFFGGGEFHF###1#???FEHDG4?3GHHGHHEDHFH0?EDGGEFHF?DA/B////?CD#11G0DFFHFH##<CGHAGCBD#<DGBCC0C?##GFGFH#F9C#FCHH#DGEGFHHFGD/FE?/G4HHGGHGF1FHHHHGHFHFFB1GGGHGHHHHGEEA0CFFBA###EB3FHDGGGGHHHHGGEGGGGGGGGGFGGGBBBBBFBAA>>#

@M00459:4:000000000-A191G:1:1101:16100:2197 1:N:0:7

GACGTAGGGCGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGNNTTGTTGCGTCGACCGTGAAAACCCGGGGCTCAACTTCGGGCTTGCGGTCGATACTGGCGGGCTGGAGTTCGGTAGGGGAGACTGGAATTCCGGGGGTAGCGGTGAAATGCGCAGATATCAGGAGGAACACCGGTGGCGAAGGCGGGTCTCTGGGCCGATACTGACGCTGAGGAGCGAAAGCGTGGGGAGCGAACAGG

+

AABBABCAAFADAGGGGGGGGGHGG?AFHHHHHGHHEEAEHH5GEFHGGEGGHG##1BB?FCF@FG//EEEEEFFHGHEE/<CCGCGCG0GB2?DD//?CGD@:<AD.=A#D<GEC<@F#BCC9C#<G#HEFG=#HFFGF;<<99BF#BF#GCC/E?EGBHEDEEEF4HFFF33E2HFGGFE>/>CDFGEGFEHDE>EEGCFFG1GGGE?E?HDFHFEGGGHHHHG2HEFEGFGGFAAFGGBBBBAFFBABAA


I have looked at the headers and don't see any differences.  I tried running 

"diff" on the stitched read and index files and got a long output that I have no idea how to interpret.  It begins like:


29a30,32

> M00459:4:000000000-A191G:1:1101:12062:3737 1:N:0:7

> M00459:4:000000000-A191G:1:1101:15752:3741 1:N:0:7

> M00459:4:000000000-A191G:1:1101:13810:3742 1:N:0:7

53a57,64

> M00459:4:000000000-A191G:1:1101:19294:3810 1:N:0:7

> M00459:4:000000000-A191G:1:1101:10215:3810 1:N:0:7

> M00459:4:000000000-A191G:1:1101:13521:3813 1:N:0:7

> M00459:4:000000000-A191G:1:1101:13385:3816 1:N:0:7

> M00459:4:000000000-A191G:1:1101:20340:3827 1:N:0:7

> M00459:4:000000000-A191G:1:1101:18682:3830 1:N:0:7

> M00459:4:000000000-A191G:1:1101:19710:3834 1:N:0:7


I have looked at both the stitched read and index files and gone to lines 29 and 30 for example to see if I can spot differences but don't see any.


My understanding was that FLASH out was formatted to use directly in QIIME.  Any suggestions?


Thanks


-Kristin

Message has been deleted
Message has been deleted

Mike

unread,
Sep 13, 2013, 3:33:07 PM9/13/13
to qiime...@googlegroups.com
Hi Kristin,

Can you provide more information on exactly how you processed the files? The above is usually an indication that the barcode data is not in the same order as the assembled data. I am guessing you used FLASH with multiple CPUs? If so, then the assembled data is in random order. So, the goal is to make sure the barcode fastq file and the assembled fastq file are in the same order.

I have attached a python script that should will help with this issue. Please let me know if it works.If not, I can tweak it for your needs. Alternatively you can run FLASH using only 1 CPU.

To use:
python remove_unused_barcodes.py <barcodes.fastq> <paired.end.assembly.fastq> <updated.barcodes.outfile.fastq>

-Mike
remove_unused_barcodes.py

Kristin Saltonstall

unread,
Sep 17, 2013, 10:35:41 AM9/17/13
to qiime...@googlegroups.com
Hi Mike,

I tried using your script and it worked!  Thank you so much.  

Another question (and I'm very new at this type of analysis so please fogive my ignorance) -  I don't understand what you mean by running FLASH using only 1 CPU vs multiple CPUs.  I have no idea how many CPUs FLASH is running on so how can I control this? I'm working on a Mac OS 10.7.5 with a 3.33 GHz 6-Core processor.  

Thanks!

-Kristin



--
 
---
You received this message because you are subscribed to a topic in the Google Groups "Qiime Forum" group.
To unsubscribe from this topic, visit https://groups.google.com/d/topic/qiime-forum/GKs2wyIjsFM/unsubscribe.
To unsubscribe from this group and all its topics, send an email to qiime-forum...@googlegroups.com.

Mike

unread,
Sep 17, 2013, 3:45:00 PM9/17/13
to qiime...@googlegroups.com
Hi Kristin,

Glad the script worked! 

According to the FLASH documentation, when using or specifying more than one CPU (e.g. -t 4) will cause the output to be out of order. I assume because there is differences in how quickly different reads are joined, causing one CPU to process data faster than another. Causing the order to change in the output. 

After typing 'flash -h at the command line you can see the description of the -t flag:

"Note: if you need FLASH's output to appear deterministically or in the same order as the original reads, you must specify -t 1"

As you can see FLASH uses 1 CPU by default. So, it must have been for some other reason that the order between the barcode and joined fastq files were not the same. 

-Mike

Doug

unread,
Mar 11, 2014, 6:12:59 PM3/11/14
to qiime...@googlegroups.com
Hey Mike,

  Is there any reason that after running this script my computer should be running very very very slow?  I started getting a crazy output in my Terminal window and promptly shut it down so I can't share the output with you...but it was printing everything out from QIIME and other python scripts on my computer completely unrelated to QIIME.  I don't know if anyone else has had this problem but I can't even open a Finder window without a spinning wheel after a hard shut down.  

Doug

Mike R

unread,
Mar 12, 2014, 10:49:00 AM3/12/14
to qiime...@googlegroups.com
Hi Doug,

Well it sounds like your machine may have run out of memory and became slow. I do not know why those other symptoms appeared. That script was written rather hastily and is somewhat inefficient (it reads the entire index file into memory). I'd suggest using join_paired_ends.py with the -b option to join the pairs and remove unused barcodes.

-Mike
Reply all
Reply to author
Forward
0 new messages