Plink 1.9 Clump warning: No significant --clump results. Skipping

JYL

unread,

Jul 18, 2019, 4:40:30 PM7/18/19

to plink2-users

log file:

PLINK v1.90b6.10 64-bit (17 Jun 2019)

Options in effect:

--bfile /Users/jingyuli/Desktop/PRS Group/data/Chromosome info/1kgp_chr1_nonDup

--clump /Users/jingyuli/Desktop/PRS Group/data/cvd data/nielsen-thorolfsdottir-willer-NG2018-AFib-gwas-summary-statistics-chr22-plink.txt

Hostname: lawn-128-61-120-150.lawn.gatech.edu

Working directory: /Users/jingyuli/Desktop/PRS Group/data/Chromosome info

Start time: Thu Jul 18 16:38:01 2019

Random number seed: 1563482281

16384 MB RAM detected; reserving 8192 MB for main workspace.

6467272 variants loaded from .bim file.

2504 people (0 males, 0 females, 2504 ambiguous) loaded from .fam.

Ambiguous sex IDs written to plink.nosex .

Using 1 thread (no multithreaded calculations invoked).

Before main variant filters, 2504 founders and 0 nonfounders present.

Calculating allele frequencies... done.

Total genotyping rate is 0.999841.

6467272 variants and 2504 people pass filters and QC.

Note: No phenotypes present.

Warning: No significant --clump results. Skipping.

End time: Thu Jul 18 16:38:11 2019

I have been getting the same warning message when I tried to run LD clumping in plink and I have also tested different p1, p2 values. Anyone knows how to resolve this issue?

Christopher Chang

unread,

Jul 18, 2019, 4:53:56 PM7/18/19

to plink2-users

Can you post the first 10 lines of your .bim file and your summary-statistic file?

JYL

unread,

Jul 18, 2019, 5:07:34 PM7/18/19

to plink2-users

here are the first 10 lines of my bim file and ss:

bim

1 rs367896724 0 10177 AC A

1 rs540431307 0 10235 TA T

1 rs555500075 0 10352 TA T

1 rs548419688 0 10505 T A

1 rs568405545 0 10506 G C

1 rs534229142 0 10511 A G

1 rs537182016 0 10539 A C

1 rs572818783 0 10542 T C

1 rs538322974 0 10579 A C

1 rs376342519 0 10616 CCGCCGTTGCAAAGGCGCGCCG C

summary statistics

SNP chr pos EA NEA BETA P

rs587743568 22 16050783 G A 6.47 0.031030000000000002

rs12172168 22 16050822 G A -0.0012 0.9628

rs367963583 22 16050922 G T -1.09 0.5238

rs188945759 22 16050984 G C -1.28 0.5304

rs587623720 22 16051269 G T -1.66 0.3144

rs192339082 22 16051477 C A 0.2826 0.1552

rs587776127 22 16052428 G A 0.861 0.4461

rs587718616 22 16053238 G A 0.28600000000000003 0.4394

rs587721086 22 16053248 C T 0.9415 0.1405

rs587598082 22 16053249 C T -0.354 0.3821

rs80167676 22 16053444 T A -0.0627 0.09559

Christopher Chang

unread,

Jul 18, 2019, 5:59:38 PM7/18/19

to plink2-users

Oh, your .bim file is for chr1 and your --clump file is for chr22, so there are no variants in common.

Reply all

Reply to author

Forward