Converting Ion Torrent Amplicon Data (V3-V4) to PICRUSt2-Compatible Files (.fna and .biom)

[Subhrangshu Mandal]

---

Topic: Converting Ion Torrent Amplicon Data (V3-V4) to PICRUSt2-Compatible Files (.fna and .biom)

Hi PICRUSt2 Community,

I’m working with Ion Torrent amplicon (V3-V4) sequencing data that has already been demultiplexed. The data is in FASTQ format, and the sequences look like this:

@27D1N:01366:11662 CCTACGGGAGGCAGCAGTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGCTTTCGGGTCGTAAAACTCTGTTGTTAGGGAAGAACAAGTACGAGAGTAACTGCTCGTACCTTGACGGTACCTAACCAGAAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGTAAT + :699;<>7::6::;;999=??4:6::<6<6<=>7<;7;:555*599;<===7=<==7:::689;<:886...54044<==8==@8>>===>?7?>==::4:<6;;=7<8<<8<=9====8898:<<8>>===<;=<<8=7>:::..-;68:49289:9-674:><67788;;;<<==<:=<<;9:6;83/--)- @27D1N:01374:11722 CCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTTAGCAGGGAAGAAGCGAAAGTGACGGTCCTAGCAGAAAAAAGCGCCGGCTAACTACGTGACCAGCAGCCGCGGTAAT + B9>==?C=<<8<<:<<===?@5>9<<<8=>===:===7<988.6;5=<777:<<<?9<=<9<<<<<=<>7===;;;582:5::9397<;;<4;6:8888)8:;<<>7=9>>8<<888*7<::9:4774...7:777777%7;8728387837-,,,,,,,2478::95944-43-3

I need help converting these FASTQ files into PICRUSt2-compatible formats:

• .fna: A FASTA file with the sequences.
• .biom: A feature table in BIOM format.

Here’s what I’ve tried:

1. Converting the FASTQ to FASTA using the FASTX-toolkit.
2. Running qiime tools import for further processing in Qiime2.

But I’m unsure about how to:

• Generate the amplicon sequence variants (ASVs) for a feature table.
• Create the corresponding .biom file for PICRUSt2 analysis.

If anyone has advice on the steps to follow or suggestions for using PICRUSt2 (or related tools), I’d really appreciate it!

Thanks in advance for your help! 😊

---

[Robyn Wright]

Hi there,

You'll need to process your data using a regular amplicon sequencing workflow first - QIIME2 is probably the most widely used and extensively documented. You can find some of their tutorials here, or we have a standard workflow here. Most tutorials you'll find will be for Illumina data, so you might need to make some modifications to some steps. At the end of a QIIME2 workflow, you will have a feature table and representative sequences. If you look at Beginner Microbiome Analysis Modules 1 and 2 here then we give an overview of the steps involved along with YouTube recordings from a workshop last year.  

Robyn