input preparation

[user]

Hello everyone,

I have a question regarding the input of picrust2;
I have the seq file in this format:
>1509752726.1| HC_5_2--ERR277718|frequency:5
CCUGGGCAGACGGGACGCAGCAGUGCGGGACGCAGCAGUGGCAGCGGGACGCAGCAGUGC
>SRR5752.1024.440 | Bacteria;Proteobacteria;Gammaproteobacteria;Pseudomonadales;Pseudomonadaceae;Pseudomonas; |  sample1
CGGGACGCAGCAGUGAGUCGGGACGCAGCCAGUGGUGGGGAAUAUUGGACAAUGGGCGAAA

and the counts files that contain phylum and genus with their read counts e.g.
Acidisoma 2435

can I do the analysis with these two files?
Thank you in advance

[Robyn Wright]

Hello, 

You can see some example data files on the tutorial page here: https://github.com/picrust/picrust2/wiki/PICRUSt2-Tutorial-(v2.5.2)

But from how I understand what you have currently, it won’t work as is but you can probably reformat it. You will need the name of each sequence in your fasta file to match the rows in your feature count table. 

Robyn