Cloning protocol

[Jin]

Hello, 

Thank you for a very nice paper. 

I wonder whether you could provide a detailed protocol for cloning sgRNA to Perturb-seq GBC library (Addgene cat. 85968)

I saw your very detailed protocol about pooled cloning of perturb-seq libraries with pPS. But I would like to do some individual cloning (Total 6 genes) and would appreciate to have a detail protocol for individual cloning as well. In the paper, it was described to use Blpl and BstXl but it would be a great help to get some detail info such as the exact sequence flanking sgRNA etc.

Thank you for your time. 

Best, 

Jin

[Atray Dixit]

Hi Jin,

Sure I don't have a detailed cloning protocol off hand but I would say you can apply the same cloning strategy as that used in a standard oligo cloning approach

With respect to flanking sequence the approach is as follows (the first pair of | refers to the BlpI cut and the second to the BstXI cut) :

GC|TTAGCTCTTAAACGGGTGGTGCCCATCCTGGTCCAACAAG|GTGG

CGAAT|CGAGAATTTGCCCACCACGGGTAGGACCAGGTT|GTTCCACC

In order to order sgRNAs, I'll use an example for our sgStat2_2 guide (forward referring to the actual sgRNA sequence as it should be transcribed, CAPITALIZED, reverse is the complementary strand):

m_Stat2_2_for	ttgGTCAGAGTCCAAATGGCGCAGgtttaagagc
m_Stat2_2_rev	ttagctcttaaacCTGCGCCATTTGGACTCTGACcaacaag

the lower case letters refer to the appended sequence required for annealing to the restriction overhangs and replacing part of the scaffold and mU6 promoter sequence that is removed.

I hope that helps

Atray

[jinsoo...@gmail.com]

Hi Atray, 

Thank you so much for the information! Your explanation is very clear. I just placed an order for some sgRNAs to have a test run. 

I really appreciate you for sharing the details. 

Best, 

Jin