PCR Troubleshooting

136 views
Skip to first unread message

c.surridge

unread,
Jun 6, 2013, 9:53:00 AM6/6/13
to nature-protoc...@googlegroups.com
Bio logy
Tuesday, 03 Jul 2012 13:50 UTC


I ran PCR then ran the product through an agarose gel. I cut 2 bands out from my gel (same primers different cell line) and isolated the DNA. It was sent out to be sequenced and when it came back I couldn’t find a matching sequence using BLAST. Do you know what could have caused this? Or do you know another search I should try? This is the sequence that we got if that helps:

"NNNNNNNNCNCATGCNNNNGCCGCCATGGCCGCGGGAT’TTGACTCCAGCAGGGCTTCGAA’CCTGCCCGGCATTGCCACTGGCAGATGATCGATGTTGAGTTCAAGGCGATGGCTGGTTGCTACATTCAGACGTCGCTTGCCGGCGTTTCGGGCATCGTAGTGCATGGGAACGCCCTGACGTTGCAAGAGTGGGCCTACTCGTTGACGCCGACTGCTTGGTTGTTTCCGAAGCGGTTCGATATCGCAACGCCGGCGCCGACAGAGCCGATCGCAGTGCCGGCAATCGAAGCGCCGGAGCCCATCATCCGCAAAGTCTCAAAGGCCGCGCCACCCAAGGCCGGCCAGATGGCGTTCGACTTCACTGTCCCGCCAAACATGGCAGAAAGGAAATCAACATGACTGACAATGAGGATGGCGCAATGACGCCAGAGGAACATCGTCTCGAAGACCTCAAGCAGATGGCTGCCTACTCTGGCCCGATCGTCTCGCTCGAGGCAAGCGAGCCCTACTATCTTGCCTCATGTGATCATTGCGGCTGGGTAGGCTCG’TCGAAGCCCTGCTGGAGTCAA’ATC"

1. The 1-22 or 27 is 16S rRNA or pGEM vector 
2. The 20-40 and the 530-550 parts are reverse complementary, of which the parts in quotations matches the primer (981-961).

c.surridge

unread,
Jun 6, 2013, 9:53:36 AM6/6/13
to nature-protoc...@googlegroups.com

Kasim Diril

03 Aug 2012 | 09:42

Have you checked the sequence densitograms?
Most likely your sequencing PCR didn’t work and you don’t have clearly defined traces.

c.surridge

unread,
Jun 6, 2013, 9:54:16 AM6/6/13
to nature-protoc...@googlegroups.com

Shivasankari Gomathinayagam

Did you run a negative control during PCR ? If yes, did it show a band too ? I had a situation in which the PCR gave me a perfect band with the expected molecular weight but they were not what I wanted. Some non-specific one.

Like Kasim said, check your chromatogram !

SS

Message has been deleted

Dishant Sharma

unread,
Jul 5, 2013, 3:38:36 PM7/5/13
to nature-protoc...@googlegroups.com
If you have a predicted sequence and the result after sequencing going to be actual sequence. Try to find the sequence manually (using MS Word search option). In most instances,  I had both Forward and Reverse compliment sequences in same word file ...
Reply all
Reply to author
Forward
0 new messages