Problems with Name Checker of Mutalyzer

[姚娜娜]

Dear Developers of mutalyzer:

I am a researcher from china, and my name is Nana,Yao. I am using Name Checker and  some problems were melt, I am writing this letter to ask you to do me a favor.

I hava a variant of (11 70666513 . G A) and was annotated with snpEff ,here is the result:

11      70666513        .       G       A       1801.6  PASS   ANN=A|synonymous_variant|LOW|SHANK2|SHANK2|transcript|NM_012309.4|protein_coding|13/27|c.1302C>T|p.Gly434Gly

Which indicated that the variant was annotated with SHANK2 of NM_012309.4:c.1302C>T p.Gly434Gly. And the sequence of the positon is displayed by the ucsc browser:

Which indicated that the sequence of the nearby variation is (antisense strand) :

  AGGCTGGGCGG C GCAGGCGAGG

 

BUT,when I check the variant description of NM_012309.4:c.1302C>T with Name Checker,the result show a different sequence :

 TCAATGCCAGCGCTCCCGACTGGGC C GTCTGCTCCACGGCCACCTCGCACC

So I am wondering what happened with this,  and hoping to hear from you soon.

Also, pictures are uploaded as attachments.

 

Sincerely : Nana, Yao

 

 

[J.F.J. Laros]

Dear Yao Nana,

Thank you for using Mutalyzer.

I think this is an error in snpEff. There is probably a difference between the
transcript that is annotated on the genome (NC_000011.9(NM_012309.4)) and the
RefSeq transcript (NM_012309.4).

If you use NC_000011.9(NM_012309.4):c.1302C>T in Mutalyzer, the result is as
you expect.


With kind regards,
Jeroen.

On Thu, Apr 15, 2021 at 08:45:58PM +0800, 姚娜娜 wrote:
> Dear Developers of mutalyzer:
>
> I am a researcher from china, and my name is Nana,Yao. I am using Name Checker and some problems were melt, I am writing this letter to ask you to do me a favor.
>
> I hava a variant of (11 70666513 . G A) and was annotated with snpEff ,here is the result:
>
> 11 70666513 . G A 1801.6 PASS ANN=A|synonymous_variant|LOW|SHANK2|SHANK2|transcript|NM_012309.4|protein_coding|13/27|c.1302C>T|p.Gly434Gly
>
> Which indicated that the variant was annotated with SHANK2 of NM_012309.4:c.1302C>T p.Gly434Gly. And the sequence of the positon is displayed by the ucsc browser:
>

> Which indicated that the sequence of the nearby variation is (antisense strand) :
>
> AGGCTGGGCGG C GCAGGCGAGG
>
>
>
> BUT,when I check the variant description of NM_012309.4:c.1302C>T with Name Checker,the result show a different sequence :
>
> TCAATGCCAGCGCTCCCGACTGGGC C GTCTGCTCCACGGCCACCTCGCACC
>
>
>
>
>
>
>

> So I am wondering what happened with this, and hoping to hear from you soon.
>
> Also, pictures are uploaded as attachments.
>
>
>
> Sincerely : Nana, Yao
>
>
>
>
>
>

> --
> You received this message because you are subscribed to the Google Groups "Mutalyzer" group.
> To unsubscribe from this group and stop receiving emails from it, send an email to mutalyzer+...@googlegroups.com.
> To view this discussion on the web visit https://groups.google.com/d/msgid/mutalyzer/5ecf9087.6569.178d5911448.Coremail.yaonana0416%40163.com.







--
Jeroen F.J. Laros - J.F.J...@lumc.nl