What input formats does jModelTest accept?

165 views
Skip to first unread message

Bob Harris

unread,
Oct 27, 2022, 10:49:52 AM10/27/22
to ModelTest-NG discussion group
In the PDF manual for v2.1.10, section 6.1 Converting Alignment Files says: "jModelTest accepts several input alignment file formats ..."

It would be helpful to know which alignment file formats it accepts. I have an alignment in MAF (http://genome.ucsc.edu/FAQ/FAQformat#format5) which is a quite common format. But I ran a small example and my input file was rejected.

So it seems my only options are to make my input look like example-data/aP6.fas, or to dig through the code to figure out what other formats might be accepted.

In particular, I have several independent alignment blocks, each with aligned sequence for 7 species (the same 7 in all blocks). It's not clear how to make that look like looking at example-data/aP6.fas.

Diego Darriba

unread,
Oct 28, 2022, 5:50:44 AM10/28/22
to modelt...@googlegroups.com

Hi Bob,

jModelTest uses ALTER to handle MSA formats. The accepted ones are: ALN, FASTA, GDE, MEGA, MSF, NEXUS, PHYLIP, and PIR.

There are several tools you can use to convert MSF to other formats. I recommend PHYLIP or FASTA. For example Seaview (http://pbil.univ-lyon1.fr/software/seaview3.html), or this script https://github.com/EvolBioInf/andi/blob/master/scripts/maf2phy.awk

--
You received this message because you are subscribed to the Google Groups "ModelTest-NG discussion group" group.
To unsubscribe from this group and stop receiving emails from it, send an email to modeltest-ng...@googlegroups.com.
To view this discussion on the web visit https://groups.google.com/d/msgid/modeltest-ng/882caf49-9099-4281-9059-d066098218abn%40googlegroups.com.

Bob Harris

unread,
Oct 28, 2022, 10:49:06 AM10/28/22
to Diego Darriba, modelt...@googlegroups.com
Thanks, Diego,

One more question. If I have multiple alignment blocks, like this:

a 833
s apple  9746 20 + 287047 TTTACATTCTAATGAATAGC
s orange 8700 20 + 297689 TATACATT---ATGAATAGC

a 1627
s apple  3444 30 + 287047 GCTCAGAT--GCATG-CGCTAAGAGCGAGA
s orange 4318 30 + 297689 GCTCGAATTTGCATGACGCTAA--GCGAGA

Is the right thing to do, to feed them into jModelTest, just to concatenate them, like this?

>apple
TTTACATTCTAATGAATAGCGCTCAGAT--GCATG-CGCTAAGAGCGAGA
>orange
TATACATT---ATGAATAGCGCTCGAATTTGCATGACGCTAA--GCGAGA

Thanks,
Bob H
Reply all
Reply to author
Forward
0 new messages