error 141

[TR]

Came across this pipeline in my research and decided to give it a go with some of my RNAseq data. After getting it installed I've come to a roadblock with error 141:

#Running sample '1AT24_1':
    #Running Module1 >>Quality Control<< ... (Date: '06-01-17' Time: '14h:01m:47s EST')

real    4m23.341s
user    4m28.878s
sys    0m11.860s

real    4m23.341s
user    4m27.242s
sys    0m12.374s

 #Error# Pipeline exited with error code 141.

So it looks like QC begins to run on my first sample but then quits a some point.  Given the lack of error description I'm at a loss as to whats wrong.  Any help would be appreciated...

Thanks,
T.R.

[metatr...@gmail.com]

Hi Thomas,

1) "#Error# Sequence './0-Sequences/' file not found."
We discussed this error within Zohaib thread. Normally this is caused because
the input fastq files are not placed in the "0-Sequences/" folder or because
the metadata do not hold the right filename. E.g. if the metadata contains:
#SampleName    SampleFiles    Shortname    Description    Order    Type ...
Sample1    Sample1_1.fastq,Sample1_2.fastq    ...

Then the files "Sample1_1.fastq,Sample1_2.fastq" must be placed within "0-Sequences/" folder.

2) "./metatrans: line 361: ./0-Software/scripts/getMeta.py: Permission denied"
Seems like a permission-related problem so please grant the script full permissions to
discard a permission-related problem:

chmod 777 ./0-Software/scripts/getMeta.py

If the error disappears then you can better tune the permissions of the script to fill
your needs.

3) "#Running sample '1AT24_1':

    #Running Module1 >>Quality Control<< ... (Date: '06-01-17' Time: '14h:01m:47s EST')

real    4m23.341s
user    4m28.878s
sys    0m11.860s

real    4m23.341s
user    4m27.242s
sys    0m12.374s

 #Error# Pipeline exited with error code 141."

This error suggests us that it might be related to the linux distribution you are using.
The pipeline was tested using Ubuntu 12.04/14.04, are you using RedHat/CentOS distribution?
if so, please revise the thread opened by Wouter. There you will find explanations to
make the pipeline work in such distros.

If that's not your case, please revise the last log produced by the pipeline
when running the Quality Control module. Typically check the last modified file
within  "1-PROCESSED_SAMPLES/1AT24_1/1-QC/m1-log/" folder.

Greetings

[karen.ro...@gmail.com]

Hi,

I'm getting the same error, #Error# Pipeline exited with error code 141.

My files are all correctly in the sequences folder, and the metadata is correct. My GLIBC is 2.17, so there shouldn't be any issues with that. I'm getting the following errors in my m1-log/output_kraken_stage_reaper.log file

[sw] matrix size (302 x 35) does not fit in data segment
sw error in nip_and_tuck

[reaper] (not overly important) dispatch category counts do not add up to input total
[reaper] check 0 errors, 0 reads truncated, 0 clean, 0 lint, 9070708 total

Checking Reaper output
There are no barcodes used within this lane, so screen for barcoded files skipped
All Reaper output files appear to be present

Sequence Imp is skipping Tally at this point to allow it to be inititated on paired files in parallel.

Summarising trinucleotide complexity for paired end files
Recording trinucleotide complexity in relation to read length

Preparing to plot QC data for Reaper
Beginning plots
Beginning plots for lane
Error in plot.window(xlim, ylim, log = log, ...) :
  need finite 'ylim' values
Calls: simplelengthPlot -> barplot -> barplot.default -> plot.window
In addition: Warning message:
In max(simpleLenTable[-1, "millions"]) :
  no non-missing arguments to max; returning -Inf
Execution halted

Any ideas about what's going on?

Thanks,

Karen

[metatr...@gmail.com]

Hi Karen,

A good starting point to debug this might be to test the sample dataset provided in the website in the Download section described in the README file of that section.
The example dataset should work with no issues. The error code 141 seems related to a pipes.

Kraken quality control step uses R to make plots, check R version and packages versions(see below), since the error you get seems related to R.

If you get new issues when running the example dataset , please check which soft/tools differ in their versions to the ones you have in your environment:

Ubuntu(12.04/14.04)   #If using  RedHat/CentOS please read the thread " Is the Metatrans pipeline works now in the RedHat/CentOS ? "
Perl(v5.14.2),
Python(v2.7.3),
R(R: v3.1.2; R.utils: v1.34.0; RColorBrewer: v1.1.2; gplots: v2.16.0; ggplot2: v1.0; GenomicRanges: v1.18.4; IRanges: v2.0.1; ShortRead: v1.24.0; DESeq2:  v.1.6.3;), 
Java(v1.7.0_65-OpenJDK64),
Bash(v4.2.25), Dash(v0.5.7),
GNU Awk(v3.1.8), C, C++.

In order to debug, might be useful to run a part  the last command that is rising the error, to find it please revise the last command of the tabular file from:
1-PROCESSED_SAMPLES/YOUR_SAMPLE/1-QC/m1-log/m1-time.tsv
and run it independently.

Find here a comparison of a normal output using the example dataset and your output:

Typical Run	Your output
-----------------------

[sw] matrix size (302 x 35) does not fit in data segment

The following command is being passed to Reaper:	sw error in nip_and_tuck
reaper -meta XXX/MetaTrans/1-PROCESSED_SAMPLES/C196CACXX_1_10/1-QC/m1-temp/kraken_results/krakened_C196CACXX_1_10_1//metadata/metadata.txt -i XXX/MetaTrans/1-PROCESSED_SAMPLES/C196CACXX_1_10/1-QC/m1-temp/kraken_results/krakened_C196CACXX_1_10_1//data//kraken_results_C196CACXX_1_10_1.fastq -format-clean '@%I%t%J%ttri=%T%n%C%n+%n%Q%n' -basename XXX/MetaTrans/1-PROCESSED_SAMPLES/C196CACXX_1_10/1-QC/m1-temp/kraken_results/krakened_C196CACXX_1_10_1//REAPER//krakened_C196CACXX_1_10_1 -geom no-bc       -3p-global 14/2/0       -3p-prefix 8/2/0/0      -3p-head-to-tail 0      -mr-tabu 14/2/1 -clean-length 30        -nnn-check 3/5  -qqq-check 43/5
-----------------------
[reaper] scanned line 1 sinsert3p [NA] barcode3p [NA] adaptor3p [AGATCGGAAGAGCACACG] cat3p [NA] barcode5p [NA] sinsert5p [NA] tabu [TACACTCTTTCCCTACACGACGCTCTTCCGATCT]
---
mRpm   million reads per minute
mNpm   million nucleotides per minute
mCps   million alignment cells per second
lint   total removed reads (per 10K), sum of columns to the left
25K reads per dot, 1M reads per line  seconds  mr mRpm mNpm mCps {error qc  low  len  NNN tabu nobc cflr  cfl lint   OK} per 10K
........................................   33   1  1.8  138  121    0    0    0    8    0    6    0    0    0   63 9937
.................

[reaper] (not overly important) dispatch category counts do not add up to input total

[reaper] check 0 errors, 0 reads truncated, 1435859 clean, 8737 lint, 1444596 total

[reaper] check 0 errors, 0 reads truncated, 0 clean, 0 lint, 9070708 total

Checking Reaper output	Checking Reaper output
There are no barcodes used within this lane, so screen for barcoded files skipped	There are no barcodes used within this lane, so screen for barcoded files skipped
All Reaper output files appear to be present	All Reaper output files appear to be present
Sequence Imp is skipping Tally at this point to allow it to be inititated on paired files in parallel.	Sequence Imp is skipping Tally at this point to allow it to be inititated on paired files in parallel.
Summarising trinucleotide complexity for paired end files	Summarising trinucleotide complexity for paired end files
Recording trinucleotide complexity in relation to read length	Recording trinucleotide complexity in relation to read length
Preparing to plot QC data for Reaper	Preparing to plot QC data for Reaper
Beginning plots	Beginning plots

Beginning plots for lane	Beginning plots for lane
Beginning general plots

Error in plot.window(xlim, ylim, log = log, ...) :

The lane does not contain multiplexed samples so the barcode split plot is skipped	need finite 'ylim' values
Plots complete

Calls: simplelengthPlot -> barplot -> barplot.default -> plot.window

	In addition: Warning message:
	In max(simpleLenTable[-1, "millions"]) :
	no non-missing arguments to max; returning -Inf
	Execution halted

We cannot provide further assistance right now, sorry for the inconvenience
Cheers